

Drug discovery
40
drugs
With orphan designations
Overview
Proximal spinal muscular atrophy (SMA) is an autosomal recessive neurodegenerative disorder caused by mutations in SMN1, leading to progressive muscle weakness due to alpha motor neuron degeneration. It is classified into types 1–4 by onset age and severity, with type 1 (infantile-onset) being the most severe and type 4 (adult-onset) the mildest. Key features include hypotonia, respiratory insufficiency, and motor milestone loss, modified by SMN2 copy number [1][2][9][11][16].
Burden
High morbidity/mortality: Type 1 historically fatal by age 2 without intervention; respiratory failure remains a leading cause of death [1][4][11].
Disability: 403 DALYs/100,000 (86% from premature mortality); 58.4 YLDs/100,000 in chronic SMA cases [4][14].
Economic impact: Annual costs average €114,000/patient (type I: €395,000), driven by multidisciplinary care and therapeutics [4][19].
Therapies
SMN-targeted therapies:
Nusinersen (antisense oligonucleotide enhancing SMN2 splicing) [3][8][13].
Risdiplam (oral small molecule increasing SMN protein) [15].
Onasemnogene abeparvovec (AAV9-mediated SMN1 gene replacement) [3][13].
Supportive care: Non-invasive ventilation, physiotherapy, and scoliosis management [6][10][16].
Categories: rare genetic diseases, rare neurological diseases
Drug Discovery Landscape
Drug | Therapy type | Regulator | Orphan designation | Approval | Sponsor |
|---|---|---|---|---|---|
self-complementary recombinant adeno-associated viral vector (scAAV) containing a single-stranded transgene encoding a codon-optimized human SMN1 gene | gene therapies | FDA | 2025-11-10 | — | Beijing Genecradle Therapeutics Co., Ltd. |
Emugrobart | antibodies | EMA | 2025-08-22 | — | Roche Registration GmbH |
pegylated insulin-like growth factor 1 (PEG-IGF1) | proteins | FDA | 2025-07-23 | — | Sarcomed AB |
Humanised IgG1 monoclonal antibody against muscle specific kinase | antibodies | EMA | 2025-04-16 | — | Argenx |
antisense oligonucleotide (ASO) binding SMN2 pre-mRNA | oligonucleotides | FDA | 2024-01-22 | — | Biogen |
Taldefgrobep alfa | antibodies | EMA | 2023-07-25 | — | Biohaven Bioscience Ireland Limited |
Taldefgrobep Alfa | proteins | FDA | 2022-12-16 | — | Biohaven Pharmaceuticals, Inc. |
recombinant humanized IgG1-based monoclonal antibody which binds to human latent myostatin in a pH dependent manner | antibodies | FDA | 2021-12-07 | — | Genentech Inc. |
Phosphorodiamidate morpholino oligomer (5¿- CTATATATAGTTATTCAACA -3¿) | oligonucleotides | FDA | 2020-03-04 | — | Shift Pharmaceuticals Holdings, Inc. |
Reldesemtiv | small molecules | EMA | 2019-06-28 | — | Cytokinetics (Ireland) Limited |
Risdiplam [Evrysdi] | small molecules | EMA | 2019-02-26 | — | Roche Registration GmbH |
Human anti-promyostatin monoclonal antibody | antibodies | EMA | 2018-12-14 | — | Scholar Rock Netherlands B.V. |
Adeno-associated viral vector serotype hu68 containing the human SMN1 gene | gene therapies | EMA | 2018-08-24 | — | Biogen Netherlands B.V. |
recombinant adeno-associated viral vector containing a single-stranded transgene encoding a codon-optimized human SMN1 complementary deoxyribonucleic acid under the control of the chicken beta actin promoter | gene therapies | FDA | 2018-07-16 | — | Biogen Inc. |
Brinretigene vesgedparvovec | gene therapies | EMA | 2018-04-16 | — | Novartis Europharm Limited |
fully human anti-proMyostatin monoclonal antibody of the IgG4/lambda isotype that binds to human pro- and latent myostatin with high affinity | antibodies | FDA | 2018-03-22 | — | Scholar Rock |
branaplam | small molecules | FDA | 2018-01-23 | — | Novartis Pharmaceuticals Corporation |
fast skeletal muscle troponin activator | small molecules | FDA | 2017-05-11 | — | Cytokinetics, Inc. |
risdiplam [Evrysdi] | small molecules | FDA | 2017-01-04 | 2020-08-07 | Genentech, Inc., a Member of the Roche Group |
Adeno-associated viral vector serotype 9 containing the human SMN gene [Zolgensma] | gene therapies | EMA | 2015-06-19 | 2020-05-18 | Novartis Europharm Limited |
onasemnogene abeparvovec [ZOLGENSMA] | gene therapies | FDA | 2014-09-30 | 2019-05-24 | Novartis Gene Therapies, Inc. |
onasemnogene abeparvovec-brve [Itvisma] | gene therapies | FDA | 2014-09-30 | 2025-11-24 | Novartis Gene Therapies, Inc. |
5-[1-(2,6-dichlorobenzyl)piperidin-4-ylmethoxy]quinazoline-2,4-diamine dihydrochloride | small molecules | EMA | 2013-06-07 | — | Sirius Regulatory Consulting Limited |
Allogeneic motor neuron progenitor cells derived from human embryonic stem cells | cell therapies | EMA | 2013-01-24 | — | California Stem Cell (UK) Ltd |
Antisense oligonucleotide targeted to the SMN2 gene [Spinraza] | oligonucleotides | EMA | 2012-04-02 | 2017-06-01 | Biogen Netherlands B.V. |
Sodium phenylbutyrate | small molecules | EMA | 2012-01-11 | — | [INACTIVE] Orphalan |
sodium 4-phenylbutyrate | small molecules | FDA | 2011-10-18 | — | GMP-Orphan SAS |
5-[1-(2,6-dichlorobenzyl)piperidin-4-ylmethoxy]quinazoline-2,4-diamine dihydrochloride | small molecules | EMA | 2011-08-30 | — | Repligen Europe Limited |
Viral vector containing DNA encoding the human SMN protein | gene therapies | EMA | 2011-06-21 | — | University of Sheffield |
nusinersen [Spinraza] | oligonucleotides | FDA | 2011-04-18 | 2016-12-23 | Biogen, Inc |
late stage human motor neutron progenitors | RNAs | FDA | 2009-11-25 | — | Caladrius Biosciences |
5-[1-(2,6-Dichlorobenzyl)-piperidin-4-yl]methoxyquinazoline-2,4-diamine | small molecules | FDA | 2009-08-25 | — | CureSMA |
cholest-4-en-3-one, oxime | small molecules | FDA | 2009-02-17 | — | Genentech, Inc. |
ataluren | small molecules | FDA | 2008-03-10 | — | PTC Therapeutics, Inc. |
Sodium phenylbutyrate | small molecules | FDA | 2007-03-20 | — | Tikvah Therapeutics, Inc. |
Sodium phenylbutyrate | small molecules | FDA | 2007-01-25 | — | OrphaMed, Inc. |
Sodium valproate [Project Butterfly] | small molecules | EMA | 2005-08-26 | — | [INACTIVE] The Jennifer Trust For Spinal Muscular Atrophy Limited |
Glyceryl tri (4-phenylbutyrate) | small molecules | FDA | 2005-05-24 | — | Ucyclyd Pharma, Inc |
Olesoxime | small molecules | EMA | 2005-03-10 | — | Roche Registration GmbH |
Ciliary neurotrophic factor, recombinant human | proteins | FDA | 1992-04-02 | — | Syntex-Synergen Neuroscience |