RARE DISEASE
Proximal spinal muscular atrophy
Proximal spinal muscular atrophy
Proximal spinal muscular atrophy
Synonyms: SMA
Synonyms: SMA
Synonyms: SMA
Drug discovery
40
drugs
With orphan designations
Overview
Proximal spinal muscular atrophy (SMA) is an autosomal recessive neurodegenerative disorder caused by mutations in SMN1, leading to progressive muscle weakness due to alpha motor neuron degeneration. It is classified into types 1–4 by onset age and severity, with type 1 (infantile-onset) being the most severe and type 4 (adult-onset) the mildest. Key features include hypotonia, respiratory insufficiency, and motor milestone loss, modified by SMN2 copy number [1][2][9][11][16].
Burden
High morbidity/mortality: Type 1 historically fatal by age 2 without intervention; respiratory failure remains a leading cause of death [1][4][11].
Disability: 403 DALYs/100,000 (86% from premature mortality); 58.4 YLDs/100,000 in chronic SMA cases [4][14].
Economic impact: Annual costs average €114,000/patient (type I: €395,000), driven by multidisciplinary care and therapeutics [4][19].
Therapies
SMN-targeted therapies: Nusinersen (antisense oligonucleotide enhancing SMN2 splicing) [3][8][13]. Risdiplam (oral small molecule increasing SMN protein) [15]. Onasemnogene abeparvovec (AAV9-mediated SMN1 gene replacement) [3][13].
Supportive care: Non-invasive ventilation, physiotherapy, and scoliosis management [6][10][16].
Categories: rare genetic diseases, rare neurological diseases
Research Papers
169 drug discovery papers about Proximal spinal muscular atrophy, with 1 first-in-class and 3 next-in-class emerging drug candidates forecasted to outperform the average preclinical success rate. Recent publications:
169 drug discovery papers about Proximal spinal muscular atrophy, with 1 first-in-class and 3 next-in-class emerging drug candidates forecasted to outperform the average preclinical success rate. Recent publications:
categories:
Small molecules
small molecules
2026-07-19 | Real-world 12-month outcomes of Risdiplam in spinal muscular atrophy types 2 and 3: A Brazilian cohort.
Spinal Muscular Atrophy (SMA) is an autosomal recessive disorder characterized by progressive axial and proximal limb weakness, often leading to ventilatory insufficiency. Risdiplam, an oral SMN2 splicing modifier, has demonstrated efficacy across clinical trials involving both infantile and late-onset SMA. However, real-world data on its long-term safety and effectiveness remain limited. To evaluate the safety and preliminary efficacy of Risdiplam after one year of treatment in patients with SMA types 2 and 3. This retrospective, single-center study included patients with genetically confirmed SMA treated with Risdiplam at the Neuromuscular Clinic of the Hospital das Clínicas, University of São Paulo, Brazil. All participants were treatment-naïve before initiating Risdiplam and were followed for 12-months. Motor function (CHOP-INTEND, HFMS), pulmonary function (FVC, FEV₁), and necessity of G-tube were assessed at baseline, 6 m, and after one year of therapy. Sixteen patients were included (mean age 20-years, range 6-56). Eleven patients (69%) had SMA type 2, while 5 (31%) had SMA type 3. The mean untreated disease duration was 18-years (range 5-44). After 12-months, 13-patients (81%) showed apparent stabilization or improvement in motor function, while 3 (19%) exhibited motor decline. Pulmonary function improved or stabilized in 13 patients (81%) and declined in 3 (19%). Clinical decline was observed in patients with progressive scoliosis or overweight. All patients maintained exclusive oral feeding. Preliminary data from the one-year follow-up suggest that Risdiplam is safe and appears generally effective in preserving or enhancing motor, respiratory, and swallowing functions. Patients with severe skeletal deformities exhibited less favorable outcomes.
2026-01-16 | Three patients with spinal muscular atrophy who have switched treatments risdiplam following onasemnogene abeparvovec, case report
Introduction: 5q spinal muscular atrophy (SMA) is the most common motor neuron disease of childhood. Patients present with hypotonia, symmetrical proximal muscle weakness, and areflexia. Treatment responses are highly variable, even in patients treated with gene therapy approaches. CASE presentation: Patient A: A 4-year-old female was born healthy, needed no hospitalization. Cord blood was collected at birth and tested with a positive result for SMA (0 copies of SMN1, 3 copies of SMN2). She received Onasemnogene Abeparvovec (OA) at 21 days after birth. She was floppy with delayed motor development, and began to walk with support at 1 year and 2 months, but with frequent falls. Comorbidities included scoliosis, lordosis, and clubfoot. After treatment, she began to walk (with falls), and disclosed tongue fasciculation, polyminimyoclonus of the upper limbs, and proximal weakness of the lower limbs. Risdiplam was started as a combination therapy. Patient B: A male diagnosed with SMA type 2 (SMN1: 0; SMN2: 3) began symptoms at 3 days after birth with hypotonia, sat at 8 months with support (never walked). OA was introduced, but he never walked, and was started on Risdiplam. Patient C: A 4-year-old male with SMA type 2 (SMN1: 0; SMN2: 3), received OA at 2 years old. At 3 years and 8 months, he did not acquire new motor milestones, never walked. Therefore, combined therapy with Risdiplam was introduced. Discussion: SMA is a treatable disease with three approved therapies in Brazil: Nusinersen, Risdiplam, OA. We report three patients with partially responsive or refractory to OA, requiring association with Risdiplam. FINAL CONSIDERATIONS: More data related to the combination of disease-modifying therapies in real-world scenarios are needed.
2025-12-26 | Dutch rehabilitation physicians' perspectives on contracture management in children with spinal muscular atrophy: challenges in a changing landscape.
Many children with hereditary proximal spinal muscular atrophy (SMA) develop joint contractures. With the introduction of disease-modifying treatments (DMTs) for SMA, the improved functional prognosis may change the focus of (preventive) contracture management. This study aimed to describe current approaches to contracture management among Dutch pediatric rehabilitation physicians caring for children with SMA receiving DMT, and to explore the underlying considerations and clinical reasoning that inform their decisions on contracture management in the evolving therapeutic landscape. All registered pediatric rehabilitation physicians (n = 151) received a survey, addressing two main topics: (1) indication and purpose of contracture management, and (2) alignment of clinical decision-making with current guidelines. To this end, three standardized case scenarios were presented. Respondents were asked to indicate whether their current choices, were consistent with the guideline recommendations. To obtain a deeper understanding of the considerations and clinical reasoning regarding contracture management in the era of DMTs, we held an advisory group meeting. We audio-recorded the discussions and analyzed the content thematically. The response rate was 56%; 41 of these respondents were not involved in SMA care. 38 of the 44 surveys, completed by participants involved in SMA care, were suitable for analysis. All respondents (strongly) agreed about 'optimal sitting posture' being an important treatment goal, 95% agreed on 'pain prevention' and 87% on 'maintaining function'. Physicians recommended daily use of hand splints less frequently in children who started DMT before onset of symptoms (35%) than in children who started DMT at an advanced disease stage (54%). Thematic analysis revealed three themes shaping clinical reasoning: (1) functional prognosis as key element in decision-making; (2) clinical uncertainty regarding contracture intervention; and (3) incorporation of contextual factors. Dutch pediatric rehabilitation physicians describe challenges in clinical decision-making regarding contracture management in a changing landscape for SMA. The use of key principles could facilitate the process, including: (1) assessing the child's functional prognosis; (2) engaging in open discussions with parents about uncertainties arising from limited clinical experience and the evolving understanding of disease trajectories in the early post-DMT era; and (3) applying the ICF framework to incorporate contextual factors into clinical decision-making regarding contracture management.
2025-08-28 | Eosinophilic Esophagitis in a 3-Year-Old Girl with Spinal Muscular Atrophy Type 1: The First Reported Case.
Background: Spinal muscular atrophy type 1 (SMA1) is a severe neuromuscular disorder characterized by progressive muscle weakness and atrophy, including the muscles of the oral cavity and esophagus. Eosinophilic esophagitis (EoE), a chronic, allergic disease, presents with eosinophilic infiltration of the esophagus, leading to esophageal dysmotility. Feeding difficulties may occur in both conditions. So far, the coexistence of EoE and SMA1 has not been described; we present the first such case. Case presentation: The patient was a girl with SMA1 diagnosed shortly after birth, treated with nusinersen and onasemnogene abeparvovec, and fed a standard industrial diet through a gastrostomy. In her second year of life, she developed increasing symptoms: distress during feeding, regurgitation, vomiting, and weight loss. She was treated with proton pump inhibitors without clinical improvement. Gastroscopy was performed, revealing superficial epithelial damage with bleeding in the proximal esophagus. Histopathology showed chronic inflammation with up to 150 eosinophils per high-power field, microabscesses, spongiosis, and basal layer hypertrophy. The girl was diagnosed with EoE. Her diet was switched from a standard industrial formula to an amino acid-based formula, which led to marked clinical improvement, the resolution of symptoms, and appropriate weight gain. Conclusions: This case report highlights the challenges of diagnosing EoE in SMA1 patients and emphasizes the need for multidisciplinary approaches and further investigation of allergic manifestations in SMA1 patients.
2023-07-10 | Case Report: A case of spinal muscular atrophy with extensively drug-resistant Acinetobacter baumannii pneumonia treated with nebulization combined with intravenous polymyxin B: experience and a literature review.
Spinal muscular atrophy (SMA) is a neurodegenerative disease that results in progressive and symmetric muscle weakness and atrophy of the proximal limbs and trunk due to degeneration of spinal alpha-motor neurons. Children are classified into types 1-3, from severe to mild, according to the time of onset and motor ability. Children with type 1 are the most severe, are unable to sit independently, and experience a series of respiratory problems, such as hypoventilation, reduced cough, and sputum congestion. Respiratory failure is easily complicated by respiratory infections and is a major cause of death in children with SMA. Most type 1 children die within 2 years of age. Type 1 children with SMA usually require hospitalization for lower respiratory tract infections and invasive ventilator-assisted ventilation in severe cases. These children are frequently infected with drug-resistant bacteria due to repeated hospitalizations and require long hospital stays requiring invasive ventilation. In this paper, we report a case of nebulization combined with intravenous polymyxin B in a child with spinal muscular atrophy with extensively drug-resistant Acinetobacter baumannii pneumonia, hoping to provide a reference for the treatment of children with extensively drug-resistant Acinetobacter baumannii pneumonia.
gene therapies
2026-02-17 | Outcome of Pediatric Rehabilitation in SMA post gene therapy
Spinal muscular atrophy (SMA) is an autosomal recessive neuromuscular disorder marked by the degeneration of alpha motor neurons in the spinal cord, leading to progressive proximal muscle atrophy and paralysis. The incidence of SMA is notably higher in the Middle East compared to the Western world, partly due to the higher rates of consanguineous marriages in the region. Recent advances have introduced therapies such as Spinraza, Zolgensma, and Risdiplam which have been approved by the US Food and Drug Administration (FDA) and the European Medicines Agency (EMA). These treatments represent a significant shift from managing progressive neurodegeneration to achieving milder, chronic forms of the disease. The introduction of gene therapy has transformed SMA management, necessitating a comprehensive, multidisciplinary approach. This approach involves collaboration among healthcare professionals including pediatricians, neurologists, physical medicine specialists, pulmonologists, and rehabilitation experts, as well as therapists such as physical, occupational, and speech therapists and dietitians, with involving patients, caregivers, and families. This paper explores the role of rehabilitation in optimizing outcomes for pediatric SMA patients receiving gene therapy at Qatar Rehabilitation Institute. It aims to evaluate how early and comprehensive rehabilitation strategies can enhance the effectiveness of expensive interventions like gene therapy. A multidisciplinary team whose follow the standard of care ( practice guidelines for clinical care 2007-2018) at the Qatar Rehabilitation Institute provides long-term rehabilitation , integrated medical care for SMA patients post-gene therapy. This care includes positioning and bracing, supported standing, stretching, management of musculoskeletal deformities, physical exercise training (including aerobics, hydrotherapy and strengthening exercises), use of assistive devices, speech and dysphagia treatment. The study assesses the impact of these rehabilitation strategies on motor function, daily living activities, and overall quality of life. Rehabilitation play important role in improving motor function and daily performance like range of motion in SMA patients undergoing gene therapy. Early intervention and ongoing rehabilitation have contributed to better outcomes in terms of motor skills, activities of daily living, and quality of life. The shift to gene therapy necessitates an evolved approach to SMA management. Effective rehabilitation is crucial in maximizing the benefits of such costly treatments. This paper Describe improvement of SMA with intensive pediatric rehabilitation who received therapeutic intervention (gene therapy with or without Nusinersin ) in pediatric rehabilitation department in Qatar by monitoring in the score of CHOP INTENT tools / Hammersmith. This study is a retrospective observational study where data will be collected for about 18 children with SMA between age 0 to 14 years from period 01/06/2018 to 31/08/2024 who are followed up in SMA multidisciplinary clinic , Qatar Rehabilitation Institute.
2025-06-17 | Newborn screening for spinal muscular atrophy in Ukraine: from pilot project to national programme
5q-Spinal muscular atrophy (SMA) is a progressive, autosomal recessive neuromuscular disease with an incidence of 1 in 14,848 births.1 SMA is characterised by proximal muscle weakness and in severe and most frequent cases early death. Approximately 96% of SMA patients carry PCR-detectable homozygous deletions of exon 7 in the SMN1 gene.2,3 SMN2, which differs from SMN1 by minor nucleotide base variations, provides limited functional compensation. Consequently, a higher SMN2 copy number is associated with a milder disease phenotype.
2025-02-18 | [Research progress on phenotypic modifier genes in spinal muscular atrophy].
Spinal muscular atrophy (SMA) is a common fatal autosomal recessive genetic disorder in childhood, primarily caused by homozygous deletion of the SMN1 gene. Its main characteristics include the degenerative changes in the anterior horn motor neurons of the spinal cord, leading to symmetrical progressive muscle weakness and atrophy of the proximal limbs. However, SMA patients with the same genetic background often exhibit different degrees of disease severity. In addition to the well-established modifier gene SMN2, the effect of other modifier genes on clinical phenotypes should not be overlooked. This paper reviews the latest advancements in the pathogenic and modifier genes of SMA, aiming to provide a deeper understanding of the pathogenic mechanisms and phenotypic differences in SMA, as well as to offer new strategies and targets for treating this condition.
2024-10-20 | Clinicogenetic characterization and response to disease-modifying therapies in spinal muscular atrophy: real-world experience from a reference center in Southern Brazil.
Spinal Muscular Atrophy linked to chromosome 5q (SMA) is an autosomal recessive neurodegenerative disease characterized by progressive proximal muscle atrophy and weakness. This study addresses the scarcity of research on novel disease-modifying therapies for SMA in Latin America by reporting a real-world experience in Southern Brazil. This is a single-center historical cohort that included all patients diagnosed with spinal muscular atrophy at a Regional Reference Service for rare diseases. Eighty-one patients were included, of whom 7 died during follow-up. Of the remaining 74 patients, 5.4 % were classified as pre-symptomatic, 24.3 % with SMA type 1, 28.4 % with type 2, 36.5 % with type 3, and 5.4 % with type 4. The mean follow-up time ranged from 1.8 years for pre-symptomatic cases to 8.7 years for SMA types 2 and 3. Approximately 42 % of these patients received specific disease-modifying therapy, of these, 96.8 % received Nusinersen, with 19.4 % transitioning to gene therapy using Onasemnogene Abeparvovec, and 6.4 % starting Risdiplam. Most patients with SMA type 1 were on disease-modifying treatment, whereas only slightly over a third of patients with type 2 and about 10 % of type 3 were receiving such treatments. Among treated patients, 80 % demonstrated improvement in motor performance during the follow-up, with a lesser therapeutic response being associated with late initiation of treatment and low motor function scores at baseline. This real-world study reinforces the effectiveness of disease-modifying therapies for SMA in Brazil within the context of low- and middle-income countries, which is greater the earlier and the better the patient's functional status.
2024-09-10 | Rehabilitation in children with spinal muscular atrophy
Background. Spinal muscular atrophy (SMA) is a severe neuromuscular disease characterized by progressive weakness of the proximal muscles and the risk of paralysis. Most patients with SMA are children. The habilitation and rehabilitation of SMA children require a multidisciplinary approach with the formation of a team of specialists and continuous monitoring of a child’s health status. Objective : to present the methods currently proposed by the world scientific community and practical healthcare for monitoring the clinical condition and measures for rehabilitation of children with types 1–3 SMA, following which would allow them to achieve the highest possible level of independent life and mobility, as well as prevent or delay development of complications. Material and methods . The search for primary sources was carried out in electronic databases Cochrane Library, Clinical Еvidence, Google Scholar, PubMed/MEDLINE as well as in The State Register of Medicines of the Ministry of Health of the Russian Federation, the ConsultantPlus legal reference system, Google and Yandex services. Keywords and their combinations in Russian and English were used, including abbreviations: “spinal muscular atrophy”, “SMA in children”, “neuromuscular diseases”, “neuromuscular degeneration”, “SMA habilitation”, “SMA rehabilitation”, “SMA physiotherapy management”, “SMA nutrition guidelines”, “SMA exercise”, “SMA physical therapy”, “SMA contractures”, “SMA scoliosis”, “SMA consensus”. The principle of forming the review was a comprehensive presentation of methods for habilitation and rehabilitation of SMA children; therefore, materials from medical practices, social, psychological, legal and medical expert management of such patients were selected. Materials published over the past 10 years and earlier works of significant scientific interest were analyzed. Initially, 327 literature sources were found, including reviews, meta-analyses, clinical trial results, expert advice materials, clinical guidelines and recommendations of scientific communities on SMA in children. After removing duplicates and checking the eligibility according to inclusion and non-inclusion criteria, 100 scientific papers were included in the review. Results. A rehabilitation team of specialists involved in the management of pediatric patients with SMA was presented. Methods of medical rehabilitation were considered, including breathing control, exercise and stretching, physical therapy, nutritional management, orthotics and orthopedics, symptomatic pharmacotherapy, technical mobility, technological and ergometric management, zootherapy, and spinal and joint surgery. Issues of emotional, psychological and behavioral, social, educational (including genetic counseling) family support were covered. Consensus statements of leading SMA opinion leaders, clinical recommendations, and practices of scientific communities were reviewed. Conclusion . Various treatment methods for types 1–3 SMA in children are considered in scientific literatire, taking into account a multidisciplinary approach and monitoring by a professional team consisting of specialists from different fields of medicine. In addition to issues of traditional therapy, new methods of combined treatment of the disease are considered (traditional management + SMA-modifying therapy), as well as issues of social, psychological, legal and medical expert support. Patients with SMA require a structured, comprehensive rehabilitation program that should be developed individually.
antibodies
2024-05-01 | Deciphering the complexity of IGHMBP2 mutations : respiratory deficits as prognostic indicators of lifespan
According to the National Institutes of Health (NIH), over 10,000 rare diseases have been identified, impacting approximately 1 in 10 individuals, totaling around 30 million people in the United States. Nearly 90 percent of neuromuscular diseases (NMDs) fall under the category of rare diseases. Despite their low prevalence, NMDs are collectively common conditions. NMDs encompass a diverse range of neurological disorders, constituting a significant contributor to mortality and lifelong disability in both children and adults. NMDs include 5q-spinal muscular atrophy (SMA), spinal muscular atrophy with respiratory distress type 1 (SMARD1), and Charcot Marie Tooth Type 2S (CMT2S). SMA is a motor neuron disease caused by autosomal recessive mutations in the survival motor neuron gene 1 (SMN1) [1]. SMA is one of the most common genetic causes of infant mortality, with an incidence of 1:10,000 [2]. Progressive muscle weakness begins proximally and develops distally with the initial sparing of the diaphragm. As the disease progresses, intercostal muscles become weak, leading to thoracoabdominal asynchrony, a bell-shaped chest, and, eventually, respiratory failure [3]. In contrast, mutations in the immunoglobulin µ-DNA binding protein 2 human gene (IGHMBP2) gene on Chromosome 11q13 give rise to two different autosomal recessive diseases, SMARD1 and CMT2S. The first cases of SMARD1 were described in 1974 [4]. However, these putative SMARD1 cases were thought to be unusual presentations of an unknown etiology causing the most acute type of SMA, Werdnig Hoffman disease (SMA type 1). SMARD1 is a devastating disease: patients present with respiratory distress 1-2 months after birth due to bilateral diaphragmatic weakness and eventration, while xiv progressive distal to proximal muscle defects were not apparent until 3-4 months of age [4]. Conversely, the milder axonal neuropathy, CMT2S, was not described until 2014, after exome sequencing of two English female patients diagnosed previously with CMT2 but with no identified mutation [5]. In this work, we characterize a novel model for CMT2S, Ighmbp2H922Y/H922Y, and the first compound heterozygous model of SMARD1, Ighmbp2D564N/H922Y. Our studies delve into the intricate role of IGHMBP2 in the pathogenesis of SMARD1 and CMT2S, revealing significant differences between mouse models with homozygous recessive and compound heterozygous mutations. The H922Y homozygous mice exhibited a normal lifespan and did not display respiratory deficiencies. Mild motor function defects emerged later in life, consistent with CMT2S disease progression. Notably, lifespan cohorts in D564N/H922Y mice exhibited three distinct groups, contrasting with H922Y homozygous mice, which showed no reduction in lifespan. A groundbreaking aspect of the research is the identification of early respiratory pathology as a critical predictor of lifespan within the D564N/H922Y survival cohorts, independent of limb pathology. Moreover, this study uniquely separates IGHMBP2 function in respiration from limb motor function, underscoring the significant improvement in lifespan and fitness by reducing respiratory deficits. The findings establish a direct correlation between IGHMBP2 biochemical activity and disease pathogenesis associated with patient mutations in humans and mice, advancing our understanding of IGHMBP2 function and its impact on disease progression.
proteins
2026-03-12 | A case of type 2 diabetes with spinal and bulbar muscular atrophy treated with oral semaglutide while sparing muscle reduction for two years: a case report with literature review.
Semaglutide has demonstrated beneficial effects in patients with type 2 diabetes; however, its long-term impact on skeletal muscle remains uncertain, particularly in individuals with multiple risk factors for muscle decline. We report a case of a 65-year-old man with type 2 diabetes who developed progressive proximal muscle weakness and was subsequently diagnosed with spinal and bulbar muscular atrophy (SBMA), for which leuprorelin therapy was initiated. Following treatment initiation, he exhibited worsened glycemic control, increased body weight and fat mass, along with reductions in both skeletal muscle mass and strength. At the age of 72, oral semaglutide was introduced. Over the following two years, improvements in glycemic parameters and reductions in fat mass were observed. Importantly, skeletal muscle mass and strength were relatively preserved, with only a minor annual decrease in muscle mass (- 0.1 kg/year), consistent with changes reported in previous studies of semaglutide-treated patients without neuromuscular conditions. To our knowledge, this is the first reported case describing the use of semaglutide in a patient with diabetes and SBMA under leuprorelin treatment, suggesting the potential utility of GLP-1 receptor agonists in managing metabolic parameters in individuals at high risk for muscle decline.
small molecules
2026-07-19 | Real-world 12-month outcomes of Risdiplam in spinal muscular atrophy types 2 and 3: A Brazilian cohort.
Spinal Muscular Atrophy (SMA) is an autosomal recessive disorder characterized by progressive axial and proximal limb weakness, often leading to ventilatory insufficiency. Risdiplam, an oral SMN2 splicing modifier, has demonstrated efficacy across clinical trials involving both infantile and late-onset SMA. However, real-world data on its long-term safety and effectiveness remain limited. To evaluate the safety and preliminary efficacy of Risdiplam after one year of treatment in patients with SMA types 2 and 3. This retrospective, single-center study included patients with genetically confirmed SMA treated with Risdiplam at the Neuromuscular Clinic of the Hospital das Clínicas, University of São Paulo, Brazil. All participants were treatment-naïve before initiating Risdiplam and were followed for 12-months. Motor function (CHOP-INTEND, HFMS), pulmonary function (FVC, FEV₁), and necessity of G-tube were assessed at baseline, 6 m, and after one year of therapy. Sixteen patients were included (mean age 20-years, range 6-56). Eleven patients (69%) had SMA type 2, while 5 (31%) had SMA type 3. The mean untreated disease duration was 18-years (range 5-44). After 12-months, 13-patients (81%) showed apparent stabilization or improvement in motor function, while 3 (19%) exhibited motor decline. Pulmonary function improved or stabilized in 13 patients (81%) and declined in 3 (19%). Clinical decline was observed in patients with progressive scoliosis or overweight. All patients maintained exclusive oral feeding. Preliminary data from the one-year follow-up suggest that Risdiplam is safe and appears generally effective in preserving or enhancing motor, respiratory, and swallowing functions. Patients with severe skeletal deformities exhibited less favorable outcomes.
2026-01-16 | Three patients with spinal muscular atrophy who have switched treatments risdiplam following onasemnogene abeparvovec, case report
Introduction: 5q spinal muscular atrophy (SMA) is the most common motor neuron disease of childhood. Patients present with hypotonia, symmetrical proximal muscle weakness, and areflexia. Treatment responses are highly variable, even in patients treated with gene therapy approaches. CASE presentation: Patient A: A 4-year-old female was born healthy, needed no hospitalization. Cord blood was collected at birth and tested with a positive result for SMA (0 copies of SMN1, 3 copies of SMN2). She received Onasemnogene Abeparvovec (OA) at 21 days after birth. She was floppy with delayed motor development, and began to walk with support at 1 year and 2 months, but with frequent falls. Comorbidities included scoliosis, lordosis, and clubfoot. After treatment, she began to walk (with falls), and disclosed tongue fasciculation, polyminimyoclonus of the upper limbs, and proximal weakness of the lower limbs. Risdiplam was started as a combination therapy. Patient B: A male diagnosed with SMA type 2 (SMN1: 0; SMN2: 3) began symptoms at 3 days after birth with hypotonia, sat at 8 months with support (never walked). OA was introduced, but he never walked, and was started on Risdiplam. Patient C: A 4-year-old male with SMA type 2 (SMN1: 0; SMN2: 3), received OA at 2 years old. At 3 years and 8 months, he did not acquire new motor milestones, never walked. Therefore, combined therapy with Risdiplam was introduced. Discussion: SMA is a treatable disease with three approved therapies in Brazil: Nusinersen, Risdiplam, OA. We report three patients with partially responsive or refractory to OA, requiring association with Risdiplam. FINAL CONSIDERATIONS: More data related to the combination of disease-modifying therapies in real-world scenarios are needed.
2025-12-26 | Dutch rehabilitation physicians' perspectives on contracture management in children with spinal muscular atrophy: challenges in a changing landscape.
Many children with hereditary proximal spinal muscular atrophy (SMA) develop joint contractures. With the introduction of disease-modifying treatments (DMTs) for SMA, the improved functional prognosis may change the focus of (preventive) contracture management. This study aimed to describe current approaches to contracture management among Dutch pediatric rehabilitation physicians caring for children with SMA receiving DMT, and to explore the underlying considerations and clinical reasoning that inform their decisions on contracture management in the evolving therapeutic landscape. All registered pediatric rehabilitation physicians (n = 151) received a survey, addressing two main topics: (1) indication and purpose of contracture management, and (2) alignment of clinical decision-making with current guidelines. To this end, three standardized case scenarios were presented. Respondents were asked to indicate whether their current choices, were consistent with the guideline recommendations. To obtain a deeper understanding of the considerations and clinical reasoning regarding contracture management in the era of DMTs, we held an advisory group meeting. We audio-recorded the discussions and analyzed the content thematically. The response rate was 56%; 41 of these respondents were not involved in SMA care. 38 of the 44 surveys, completed by participants involved in SMA care, were suitable for analysis. All respondents (strongly) agreed about 'optimal sitting posture' being an important treatment goal, 95% agreed on 'pain prevention' and 87% on 'maintaining function'. Physicians recommended daily use of hand splints less frequently in children who started DMT before onset of symptoms (35%) than in children who started DMT at an advanced disease stage (54%). Thematic analysis revealed three themes shaping clinical reasoning: (1) functional prognosis as key element in decision-making; (2) clinical uncertainty regarding contracture intervention; and (3) incorporation of contextual factors. Dutch pediatric rehabilitation physicians describe challenges in clinical decision-making regarding contracture management in a changing landscape for SMA. The use of key principles could facilitate the process, including: (1) assessing the child's functional prognosis; (2) engaging in open discussions with parents about uncertainties arising from limited clinical experience and the evolving understanding of disease trajectories in the early post-DMT era; and (3) applying the ICF framework to incorporate contextual factors into clinical decision-making regarding contracture management.
2025-08-28 | Eosinophilic Esophagitis in a 3-Year-Old Girl with Spinal Muscular Atrophy Type 1: The First Reported Case.
Background: Spinal muscular atrophy type 1 (SMA1) is a severe neuromuscular disorder characterized by progressive muscle weakness and atrophy, including the muscles of the oral cavity and esophagus. Eosinophilic esophagitis (EoE), a chronic, allergic disease, presents with eosinophilic infiltration of the esophagus, leading to esophageal dysmotility. Feeding difficulties may occur in both conditions. So far, the coexistence of EoE and SMA1 has not been described; we present the first such case. Case presentation: The patient was a girl with SMA1 diagnosed shortly after birth, treated with nusinersen and onasemnogene abeparvovec, and fed a standard industrial diet through a gastrostomy. In her second year of life, she developed increasing symptoms: distress during feeding, regurgitation, vomiting, and weight loss. She was treated with proton pump inhibitors without clinical improvement. Gastroscopy was performed, revealing superficial epithelial damage with bleeding in the proximal esophagus. Histopathology showed chronic inflammation with up to 150 eosinophils per high-power field, microabscesses, spongiosis, and basal layer hypertrophy. The girl was diagnosed with EoE. Her diet was switched from a standard industrial formula to an amino acid-based formula, which led to marked clinical improvement, the resolution of symptoms, and appropriate weight gain. Conclusions: This case report highlights the challenges of diagnosing EoE in SMA1 patients and emphasizes the need for multidisciplinary approaches and further investigation of allergic manifestations in SMA1 patients.
2023-07-10 | Case Report: A case of spinal muscular atrophy with extensively drug-resistant Acinetobacter baumannii pneumonia treated with nebulization combined with intravenous polymyxin B: experience and a literature review.
Spinal muscular atrophy (SMA) is a neurodegenerative disease that results in progressive and symmetric muscle weakness and atrophy of the proximal limbs and trunk due to degeneration of spinal alpha-motor neurons. Children are classified into types 1-3, from severe to mild, according to the time of onset and motor ability. Children with type 1 are the most severe, are unable to sit independently, and experience a series of respiratory problems, such as hypoventilation, reduced cough, and sputum congestion. Respiratory failure is easily complicated by respiratory infections and is a major cause of death in children with SMA. Most type 1 children die within 2 years of age. Type 1 children with SMA usually require hospitalization for lower respiratory tract infections and invasive ventilator-assisted ventilation in severe cases. These children are frequently infected with drug-resistant bacteria due to repeated hospitalizations and require long hospital stays requiring invasive ventilation. In this paper, we report a case of nebulization combined with intravenous polymyxin B in a child with spinal muscular atrophy with extensively drug-resistant Acinetobacter baumannii pneumonia, hoping to provide a reference for the treatment of children with extensively drug-resistant Acinetobacter baumannii pneumonia.
gene therapies
2026-02-17 | Outcome of Pediatric Rehabilitation in SMA post gene therapy
Spinal muscular atrophy (SMA) is an autosomal recessive neuromuscular disorder marked by the degeneration of alpha motor neurons in the spinal cord, leading to progressive proximal muscle atrophy and paralysis. The incidence of SMA is notably higher in the Middle East compared to the Western world, partly due to the higher rates of consanguineous marriages in the region. Recent advances have introduced therapies such as Spinraza, Zolgensma, and Risdiplam which have been approved by the US Food and Drug Administration (FDA) and the European Medicines Agency (EMA). These treatments represent a significant shift from managing progressive neurodegeneration to achieving milder, chronic forms of the disease. The introduction of gene therapy has transformed SMA management, necessitating a comprehensive, multidisciplinary approach. This approach involves collaboration among healthcare professionals including pediatricians, neurologists, physical medicine specialists, pulmonologists, and rehabilitation experts, as well as therapists such as physical, occupational, and speech therapists and dietitians, with involving patients, caregivers, and families. This paper explores the role of rehabilitation in optimizing outcomes for pediatric SMA patients receiving gene therapy at Qatar Rehabilitation Institute. It aims to evaluate how early and comprehensive rehabilitation strategies can enhance the effectiveness of expensive interventions like gene therapy. A multidisciplinary team whose follow the standard of care ( practice guidelines for clinical care 2007-2018) at the Qatar Rehabilitation Institute provides long-term rehabilitation , integrated medical care for SMA patients post-gene therapy. This care includes positioning and bracing, supported standing, stretching, management of musculoskeletal deformities, physical exercise training (including aerobics, hydrotherapy and strengthening exercises), use of assistive devices, speech and dysphagia treatment. The study assesses the impact of these rehabilitation strategies on motor function, daily living activities, and overall quality of life. Rehabilitation play important role in improving motor function and daily performance like range of motion in SMA patients undergoing gene therapy. Early intervention and ongoing rehabilitation have contributed to better outcomes in terms of motor skills, activities of daily living, and quality of life. The shift to gene therapy necessitates an evolved approach to SMA management. Effective rehabilitation is crucial in maximizing the benefits of such costly treatments. This paper Describe improvement of SMA with intensive pediatric rehabilitation who received therapeutic intervention (gene therapy with or without Nusinersin ) in pediatric rehabilitation department in Qatar by monitoring in the score of CHOP INTENT tools / Hammersmith. This study is a retrospective observational study where data will be collected for about 18 children with SMA between age 0 to 14 years from period 01/06/2018 to 31/08/2024 who are followed up in SMA multidisciplinary clinic , Qatar Rehabilitation Institute.
2025-06-17 | Newborn screening for spinal muscular atrophy in Ukraine: from pilot project to national programme
5q-Spinal muscular atrophy (SMA) is a progressive, autosomal recessive neuromuscular disease with an incidence of 1 in 14,848 births.1 SMA is characterised by proximal muscle weakness and in severe and most frequent cases early death. Approximately 96% of SMA patients carry PCR-detectable homozygous deletions of exon 7 in the SMN1 gene.2,3 SMN2, which differs from SMN1 by minor nucleotide base variations, provides limited functional compensation. Consequently, a higher SMN2 copy number is associated with a milder disease phenotype.
2025-02-18 | [Research progress on phenotypic modifier genes in spinal muscular atrophy].
Spinal muscular atrophy (SMA) is a common fatal autosomal recessive genetic disorder in childhood, primarily caused by homozygous deletion of the SMN1 gene. Its main characteristics include the degenerative changes in the anterior horn motor neurons of the spinal cord, leading to symmetrical progressive muscle weakness and atrophy of the proximal limbs. However, SMA patients with the same genetic background often exhibit different degrees of disease severity. In addition to the well-established modifier gene SMN2, the effect of other modifier genes on clinical phenotypes should not be overlooked. This paper reviews the latest advancements in the pathogenic and modifier genes of SMA, aiming to provide a deeper understanding of the pathogenic mechanisms and phenotypic differences in SMA, as well as to offer new strategies and targets for treating this condition.
2024-10-20 | Clinicogenetic characterization and response to disease-modifying therapies in spinal muscular atrophy: real-world experience from a reference center in Southern Brazil.
Spinal Muscular Atrophy linked to chromosome 5q (SMA) is an autosomal recessive neurodegenerative disease characterized by progressive proximal muscle atrophy and weakness. This study addresses the scarcity of research on novel disease-modifying therapies for SMA in Latin America by reporting a real-world experience in Southern Brazil. This is a single-center historical cohort that included all patients diagnosed with spinal muscular atrophy at a Regional Reference Service for rare diseases. Eighty-one patients were included, of whom 7 died during follow-up. Of the remaining 74 patients, 5.4 % were classified as pre-symptomatic, 24.3 % with SMA type 1, 28.4 % with type 2, 36.5 % with type 3, and 5.4 % with type 4. The mean follow-up time ranged from 1.8 years for pre-symptomatic cases to 8.7 years for SMA types 2 and 3. Approximately 42 % of these patients received specific disease-modifying therapy, of these, 96.8 % received Nusinersen, with 19.4 % transitioning to gene therapy using Onasemnogene Abeparvovec, and 6.4 % starting Risdiplam. Most patients with SMA type 1 were on disease-modifying treatment, whereas only slightly over a third of patients with type 2 and about 10 % of type 3 were receiving such treatments. Among treated patients, 80 % demonstrated improvement in motor performance during the follow-up, with a lesser therapeutic response being associated with late initiation of treatment and low motor function scores at baseline. This real-world study reinforces the effectiveness of disease-modifying therapies for SMA in Brazil within the context of low- and middle-income countries, which is greater the earlier and the better the patient's functional status.
2024-09-10 | Rehabilitation in children with spinal muscular atrophy
Background. Spinal muscular atrophy (SMA) is a severe neuromuscular disease characterized by progressive weakness of the proximal muscles and the risk of paralysis. Most patients with SMA are children. The habilitation and rehabilitation of SMA children require a multidisciplinary approach with the formation of a team of specialists and continuous monitoring of a child’s health status. Objective : to present the methods currently proposed by the world scientific community and practical healthcare for monitoring the clinical condition and measures for rehabilitation of children with types 1–3 SMA, following which would allow them to achieve the highest possible level of independent life and mobility, as well as prevent or delay development of complications. Material and methods . The search for primary sources was carried out in electronic databases Cochrane Library, Clinical Еvidence, Google Scholar, PubMed/MEDLINE as well as in The State Register of Medicines of the Ministry of Health of the Russian Federation, the ConsultantPlus legal reference system, Google and Yandex services. Keywords and their combinations in Russian and English were used, including abbreviations: “spinal muscular atrophy”, “SMA in children”, “neuromuscular diseases”, “neuromuscular degeneration”, “SMA habilitation”, “SMA rehabilitation”, “SMA physiotherapy management”, “SMA nutrition guidelines”, “SMA exercise”, “SMA physical therapy”, “SMA contractures”, “SMA scoliosis”, “SMA consensus”. The principle of forming the review was a comprehensive presentation of methods for habilitation and rehabilitation of SMA children; therefore, materials from medical practices, social, psychological, legal and medical expert management of such patients were selected. Materials published over the past 10 years and earlier works of significant scientific interest were analyzed. Initially, 327 literature sources were found, including reviews, meta-analyses, clinical trial results, expert advice materials, clinical guidelines and recommendations of scientific communities on SMA in children. After removing duplicates and checking the eligibility according to inclusion and non-inclusion criteria, 100 scientific papers were included in the review. Results. A rehabilitation team of specialists involved in the management of pediatric patients with SMA was presented. Methods of medical rehabilitation were considered, including breathing control, exercise and stretching, physical therapy, nutritional management, orthotics and orthopedics, symptomatic pharmacotherapy, technical mobility, technological and ergometric management, zootherapy, and spinal and joint surgery. Issues of emotional, psychological and behavioral, social, educational (including genetic counseling) family support were covered. Consensus statements of leading SMA opinion leaders, clinical recommendations, and practices of scientific communities were reviewed. Conclusion . Various treatment methods for types 1–3 SMA in children are considered in scientific literatire, taking into account a multidisciplinary approach and monitoring by a professional team consisting of specialists from different fields of medicine. In addition to issues of traditional therapy, new methods of combined treatment of the disease are considered (traditional management + SMA-modifying therapy), as well as issues of social, psychological, legal and medical expert support. Patients with SMA require a structured, comprehensive rehabilitation program that should be developed individually.
antibodies
2024-05-01 | Deciphering the complexity of IGHMBP2 mutations : respiratory deficits as prognostic indicators of lifespan
According to the National Institutes of Health (NIH), over 10,000 rare diseases have been identified, impacting approximately 1 in 10 individuals, totaling around 30 million people in the United States. Nearly 90 percent of neuromuscular diseases (NMDs) fall under the category of rare diseases. Despite their low prevalence, NMDs are collectively common conditions. NMDs encompass a diverse range of neurological disorders, constituting a significant contributor to mortality and lifelong disability in both children and adults. NMDs include 5q-spinal muscular atrophy (SMA), spinal muscular atrophy with respiratory distress type 1 (SMARD1), and Charcot Marie Tooth Type 2S (CMT2S). SMA is a motor neuron disease caused by autosomal recessive mutations in the survival motor neuron gene 1 (SMN1) [1]. SMA is one of the most common genetic causes of infant mortality, with an incidence of 1:10,000 [2]. Progressive muscle weakness begins proximally and develops distally with the initial sparing of the diaphragm. As the disease progresses, intercostal muscles become weak, leading to thoracoabdominal asynchrony, a bell-shaped chest, and, eventually, respiratory failure [3]. In contrast, mutations in the immunoglobulin µ-DNA binding protein 2 human gene (IGHMBP2) gene on Chromosome 11q13 give rise to two different autosomal recessive diseases, SMARD1 and CMT2S. The first cases of SMARD1 were described in 1974 [4]. However, these putative SMARD1 cases were thought to be unusual presentations of an unknown etiology causing the most acute type of SMA, Werdnig Hoffman disease (SMA type 1). SMARD1 is a devastating disease: patients present with respiratory distress 1-2 months after birth due to bilateral diaphragmatic weakness and eventration, while xiv progressive distal to proximal muscle defects were not apparent until 3-4 months of age [4]. Conversely, the milder axonal neuropathy, CMT2S, was not described until 2014, after exome sequencing of two English female patients diagnosed previously with CMT2 but with no identified mutation [5]. In this work, we characterize a novel model for CMT2S, Ighmbp2H922Y/H922Y, and the first compound heterozygous model of SMARD1, Ighmbp2D564N/H922Y. Our studies delve into the intricate role of IGHMBP2 in the pathogenesis of SMARD1 and CMT2S, revealing significant differences between mouse models with homozygous recessive and compound heterozygous mutations. The H922Y homozygous mice exhibited a normal lifespan and did not display respiratory deficiencies. Mild motor function defects emerged later in life, consistent with CMT2S disease progression. Notably, lifespan cohorts in D564N/H922Y mice exhibited three distinct groups, contrasting with H922Y homozygous mice, which showed no reduction in lifespan. A groundbreaking aspect of the research is the identification of early respiratory pathology as a critical predictor of lifespan within the D564N/H922Y survival cohorts, independent of limb pathology. Moreover, this study uniquely separates IGHMBP2 function in respiration from limb motor function, underscoring the significant improvement in lifespan and fitness by reducing respiratory deficits. The findings establish a direct correlation between IGHMBP2 biochemical activity and disease pathogenesis associated with patient mutations in humans and mice, advancing our understanding of IGHMBP2 function and its impact on disease progression.
proteins
2026-03-12 | A case of type 2 diabetes with spinal and bulbar muscular atrophy treated with oral semaglutide while sparing muscle reduction for two years: a case report with literature review.
Semaglutide has demonstrated beneficial effects in patients with type 2 diabetes; however, its long-term impact on skeletal muscle remains uncertain, particularly in individuals with multiple risk factors for muscle decline. We report a case of a 65-year-old man with type 2 diabetes who developed progressive proximal muscle weakness and was subsequently diagnosed with spinal and bulbar muscular atrophy (SBMA), for which leuprorelin therapy was initiated. Following treatment initiation, he exhibited worsened glycemic control, increased body weight and fat mass, along with reductions in both skeletal muscle mass and strength. At the age of 72, oral semaglutide was introduced. Over the following two years, improvements in glycemic parameters and reductions in fat mass were observed. Importantly, skeletal muscle mass and strength were relatively preserved, with only a minor annual decrease in muscle mass (- 0.1 kg/year), consistent with changes reported in previous studies of semaglutide-treated patients without neuromuscular conditions. To our knowledge, this is the first reported case describing the use of semaglutide in a patient with diabetes and SBMA under leuprorelin treatment, suggesting the potential utility of GLP-1 receptor agonists in managing metabolic parameters in individuals at high risk for muscle decline.
Access all drug discovery papers and probability of success in trials forecasts:
Access all drug discovery papers and probability of success in trials forecasts:
Drug Discovery Landscape
40 orphan drug designations for Proximal spinal muscular atrophy, including 6 approved therapies.
40 orphan drug designations for Proximal spinal muscular atrophy, including 6 approved therapies.
Drug | Therapy type | Regulator | Orphan designation | Approval | Sponsor |
|---|---|---|---|---|---|
self-complementary recombinant adeno-associated viral vector (scAAV) containing a single-stranded transgene encoding a codon-optimized human SMN1 gene | gene therapies | FDA | 2025-11-10 | — | Beijing Genecradle Therapeutics Co., Ltd. |
Emugrobart | antibodies | EMA | 2025-08-22 | — | Roche Registration GmbH |
pegylated insulin-like growth factor 1 (PEG-IGF1) | proteins | FDA | 2025-07-23 | — | Sarcomed AB |
Humanised IgG1 monoclonal antibody against muscle specific kinase | antibodies | EMA | 2025-04-16 | — | Argenx |
antisense oligonucleotide (ASO) binding SMN2 pre-mRNA | oligonucleotides | FDA | 2024-01-22 | — | Biogen |
Taldefgrobep alfa | antibodies | EMA | 2023-07-25 | — | Biohaven Bioscience Ireland Limited |
Taldefgrobep Alfa | proteins | FDA | 2022-12-16 | — | Biohaven Pharmaceuticals, Inc. |
recombinant humanized IgG1-based monoclonal antibody which binds to human latent myostatin in a pH dependent manner | antibodies | FDA | 2021-12-07 | — | Genentech Inc. |
Phosphorodiamidate morpholino oligomer (5¿- CTATATATAGTTATTCAACA -3¿) | oligonucleotides | FDA | 2020-03-04 | — | Shift Pharmaceuticals Holdings, Inc. |
Reldesemtiv | small molecules | EMA | 2019-06-28 | — | Cytokinetics (Ireland) Limited |
Risdiplam [Evrysdi] | small molecules | EMA | 2019-02-26 | — | Roche Registration GmbH |
Human anti-promyostatin monoclonal antibody | antibodies | EMA | 2018-12-14 | — | Scholar Rock Netherlands B.V. |
Adeno-associated viral vector serotype hu68 containing the human SMN1 gene | gene therapies | EMA | 2018-08-24 | — | Biogen Netherlands B.V. |
recombinant adeno-associated viral vector containing a single-stranded transgene encoding a codon-optimized human SMN1 complementary deoxyribonucleic acid under the control of the chicken beta actin promoter | gene therapies | FDA | 2018-07-16 | — | Biogen Inc. |
Brinretigene vesgedparvovec | gene therapies | EMA | 2018-04-16 | — | Novartis Europharm Limited |
fully human anti-proMyostatin monoclonal antibody of the IgG4/lambda isotype that binds to human pro- and latent myostatin with high affinity | antibodies | FDA | 2018-03-22 | — | Scholar Rock |
branaplam | small molecules | FDA | 2018-01-23 | — | Novartis Pharmaceuticals Corporation |
fast skeletal muscle troponin activator | small molecules | FDA | 2017-05-11 | — | Cytokinetics, Inc. |
risdiplam [Evrysdi] | small molecules | FDA | 2017-01-04 | 2020-08-07 | Genentech, Inc., a Member of the Roche Group |
Adeno-associated viral vector serotype 9 containing the human SMN gene [Zolgensma] | gene therapies | EMA | 2015-06-19 | 2020-05-18 | Novartis Europharm Limited |
onasemnogene abeparvovec [ZOLGENSMA] | gene therapies | FDA | 2014-09-30 | 2019-05-24 | Novartis Gene Therapies, Inc. |
onasemnogene abeparvovec-brve [Itvisma] | gene therapies | FDA | 2014-09-30 | 2025-11-24 | Novartis Gene Therapies, Inc. |
5-[1-(2,6-dichlorobenzyl)piperidin-4-ylmethoxy]quinazoline-2,4-diamine dihydrochloride | small molecules | EMA | 2013-06-07 | — | Sirius Regulatory Consulting Limited |
Allogeneic motor neuron progenitor cells derived from human embryonic stem cells | cell therapies | EMA | 2013-01-24 | — | California Stem Cell (UK) Ltd |
Antisense oligonucleotide targeted to the SMN2 gene [Spinraza] | oligonucleotides | EMA | 2012-04-02 | 2017-06-01 | Biogen Netherlands B.V. |
Sodium phenylbutyrate | small molecules | EMA | 2012-01-11 | — | [INACTIVE] Orphalan |
sodium 4-phenylbutyrate | small molecules | FDA | 2011-10-18 | — | GMP-Orphan SAS |
5-[1-(2,6-dichlorobenzyl)piperidin-4-ylmethoxy]quinazoline-2,4-diamine dihydrochloride | small molecules | EMA | 2011-08-30 | — | Repligen Europe Limited |
Viral vector containing DNA encoding the human SMN protein | gene therapies | EMA | 2011-06-21 | — | University of Sheffield |
nusinersen [Spinraza] | oligonucleotides | FDA | 2011-04-18 | 2016-12-23 | Biogen, Inc |
late stage human motor neutron progenitors | RNAs | FDA | 2009-11-25 | — | Caladrius Biosciences |
5-[1-(2,6-Dichlorobenzyl)-piperidin-4-yl]methoxyquinazoline-2,4-diamine | small molecules | FDA | 2009-08-25 | — | CureSMA |
cholest-4-en-3-one, oxime | small molecules | FDA | 2009-02-17 | — | Genentech, Inc. |
ataluren | small molecules | FDA | 2008-03-10 | — | PTC Therapeutics, Inc. |
Sodium phenylbutyrate | small molecules | FDA | 2007-03-20 | — | Tikvah Therapeutics, Inc. |
Sodium phenylbutyrate | small molecules | FDA | 2007-01-25 | — | OrphaMed, Inc. |
Sodium valproate [Project Butterfly] | small molecules | EMA | 2005-08-26 | — | [INACTIVE] The Jennifer Trust For Spinal Muscular Atrophy Limited |
Glyceryl tri (4-phenylbutyrate) | small molecules | FDA | 2005-05-24 | — | Ucyclyd Pharma, Inc |
Olesoxime | small molecules | EMA | 2005-03-10 | — | Roche Registration GmbH |
Ciliary neurotrophic factor, recombinant human | proteins | FDA | 1992-04-02 | — | Syntex-Synergen Neuroscience |
Let's accelerate rare disease drug discovery
Let's accelerate drug discovery
Get access to Explority AI’s forecasts to outperform average preclinical success rates. Whether you’re expanding your R&D pipeline, evaluating a partnership, or simply have a question — we’d love to hear from you.