AI Drug Discovery for Pharma and Biotech

Drug discovery

40

drugs

With orphan designations

Overview

Proximal spinal muscular atrophy (SMA) is an autosomal recessive neurodegenerative disorder caused by mutations in SMN1, leading to progressive muscle weakness due to alpha motor neuron degeneration. It is classified into types 1–4 by onset age and severity, with type 1 (infantile-onset) being the most severe and type 4 (adult-onset) the mildest. Key features include hypotonia, respiratory insufficiency, and motor milestone loss, modified by SMN2 copy number [1][2][9][11][16].

Population

  • Prevalence: ~1/12,000 live births; type 1 accounts for ~60% of cases [1][12][11].

  • Type 2 (6–18 months) and type 3 (>18 months) represent ~30% and ~10% of cases, respectively; type 4 is rare (1% of cases) [9][11][17].

Burden

  • High morbidity/mortality: Type 1 historically fatal by age 2 without intervention; respiratory failure remains a leading cause of death [1][4][11].

  • Disability: 403 DALYs/100,000 (86% from premature mortality); 58.4 YLDs/100,000 in chronic SMA cases [4][14].

  • Economic impact: Annual costs average €114,000/patient (type I: €395,000), driven by multidisciplinary care and therapeutics [4][19].

Therapies

  • SMN-targeted therapies:

  • Nusinersen (antisense oligonucleotide enhancing SMN2 splicing) [3][8][13].

  • Risdiplam (oral small molecule increasing SMN protein) [15].

  • Onasemnogene abeparvovec (AAV9-mediated SMN1 gene replacement) [3][13].

  • Supportive care: Non-invasive ventilation, physiotherapy, and scoliosis management [6][10][16].

Categories: rare genetic diseases, rare neurological diseases

Research Papers

169 drug discovery papers about Proximal spinal muscular atrophy, with 1 first-in-class and 3 next-in-class emerging drug candidates forecasted to outperform the average preclinical success rate. Recent publications:

169 drug discovery papers about Proximal spinal muscular atrophy, with 1 first-in-class and 3 next-in-class emerging drug candidates forecasted to outperform the average preclinical success rate. Recent publications:

2026-07-19 | Real-world 12-month outcomes of Risdiplam in spinal muscular atrophy types 2 and 3: A Brazilian cohort.

Spinal Muscular Atrophy (SMA) is an autosomal recessive disorder characterized by progressive axial and proximal limb weakness, often leading to ventilatory insufficiency. Risdiplam, an oral SMN2 splicing modifier, has demonstrated efficacy across clinical trials involving both infantile and late-onset SMA. However, real-world data on its long-term safety and effectiveness remain limited. To evaluate the safety and preliminary efficacy of Risdiplam after one year of treatment in patients with SMA types 2 and 3. This retrospective, single-center study included patients with genetically confirmed SMA treated with Risdiplam at the Neuromuscular Clinic of the Hospital das Clínicas, University of São Paulo, Brazil. All participants were treatment-naïve before initiating Risdiplam and were followed for 12-months. Motor function (CHOP-INTEND, HFMS), pulmonary function (FVC, FEV₁), and necessity of G-tube were assessed at baseline, 6 m, and after one year of therapy. Sixteen patients were included (mean age 20-years, range 6-56). Eleven patients (69%) had SMA type 2, while 5 (31%) had SMA type 3. The mean untreated disease duration was 18-years (range 5-44). After 12-months, 13-patients (81%) showed apparent stabilization or improvement in motor function, while 3 (19%) exhibited motor decline. Pulmonary function improved or stabilized in 13 patients (81%) and declined in 3 (19%). Clinical decline was observed in patients with progressive scoliosis or overweight. All patients maintained exclusive oral feeding. Preliminary data from the one-year follow-up suggest that Risdiplam is safe and appears generally effective in preserving or enhancing motor, respiratory, and swallowing functions. Patients with severe skeletal deformities exhibited less favorable outcomes.

Open article ↗



2026-03-12 | A case of type 2 diabetes with spinal and bulbar muscular atrophy treated with oral semaglutide while sparing muscle reduction for two years: a case report with literature review.

Semaglutide has demonstrated beneficial effects in patients with type 2 diabetes; however, its long-term impact on skeletal muscle remains uncertain, particularly in individuals with multiple risk factors for muscle decline. We report a case of a 65-year-old man with type 2 diabetes who developed progressive proximal muscle weakness and was subsequently diagnosed with spinal and bulbar muscular atrophy (SBMA), for which leuprorelin therapy was initiated. Following treatment initiation, he exhibited worsened glycemic control, increased body weight and fat mass, along with reductions in both skeletal muscle mass and strength. At the age of 72, oral semaglutide was introduced. Over the following two years, improvements in glycemic parameters and reductions in fat mass were observed. Importantly, skeletal muscle mass and strength were relatively preserved, with only a minor annual decrease in muscle mass (- 0.1 kg/year), consistent with changes reported in previous studies of semaglutide-treated patients without neuromuscular conditions. To our knowledge, this is the first reported case describing the use of semaglutide in a patient with diabetes and SBMA under leuprorelin treatment, suggesting the potential utility of GLP-1 receptor agonists in managing metabolic parameters in individuals at high risk for muscle decline.

Open article ↗



2026-02-17 | Outcome of Pediatric Rehabilitation in SMA post gene therapy

Spinal muscular atrophy (SMA) is an autosomal recessive neuromuscular disorder marked by the degeneration of alpha motor neurons in the spinal cord, leading to progressive proximal muscle atrophy and paralysis. The incidence of SMA is notably higher in the Middle East compared to the Western world, partly due to the higher rates of consanguineous marriages in the region. Recent advances have introduced therapies such as Spinraza, Zolgensma, and Risdiplam which have been approved by the US Food and Drug Administration (FDA) and the European Medicines Agency (EMA). These treatments represent a significant shift from managing progressive neurodegeneration to achieving milder, chronic forms of the disease. The introduction of gene therapy has transformed SMA management, necessitating a comprehensive, multidisciplinary approach. This approach involves collaboration among healthcare professionals including pediatricians, neurologists, physical medicine specialists, pulmonologists, and rehabilitation experts, as well as therapists such as physical, occupational, and speech therapists and dietitians, with involving patients, caregivers, and families. This paper explores the role of rehabilitation in optimizing outcomes for pediatric SMA patients receiving gene therapy at Qatar Rehabilitation Institute. It aims to evaluate how early and comprehensive rehabilitation strategies can enhance the effectiveness of expensive interventions like gene therapy. A multidisciplinary team whose follow the standard of care ( practice guidelines for clinical care 2007-2018) at the Qatar Rehabilitation Institute provides long-term rehabilitation , integrated medical care for SMA patients post-gene therapy. This care includes positioning and bracing, supported standing, stretching, management of musculoskeletal deformities, physical exercise training (including aerobics, hydrotherapy and strengthening exercises), use of assistive devices, speech and dysphagia treatment. The study assesses the impact of these rehabilitation strategies on motor function, daily living activities, and overall quality of life. Rehabilitation play important role in improving motor function and daily performance like range of motion in SMA patients undergoing gene therapy. Early intervention and ongoing rehabilitation have contributed to better outcomes in terms of motor skills, activities of daily living, and quality of life. The shift to gene therapy necessitates an evolved approach to SMA management. Effective rehabilitation is crucial in maximizing the benefits of such costly treatments. This paper Describe improvement of SMA with intensive pediatric rehabilitation who received therapeutic intervention (gene therapy with or without Nusinersin ) in pediatric rehabilitation department in Qatar by monitoring in the score of CHOP INTENT tools / Hammersmith. This study is a retrospective observational study where data will be collected for about 18 children with SMA between age 0 to 14 years from period 01/06/2018 to 31/08/2024 who are followed up in SMA multidisciplinary clinic , Qatar Rehabilitation Institute.

Open article ↗



2026-01-16 | Three patients with spinal muscular atrophy who have switched treatments risdiplam following onasemnogene abeparvovec, case report

Introduction: 5q spinal muscular atrophy (SMA) is the most common motor neuron disease of childhood. Patients present with hypotonia, symmetrical proximal muscle weakness, and areflexia. Treatment responses are highly variable, even in patients treated with gene therapy approaches. CASE presentation: Patient A: A 4-year-old female was born healthy, needed no hospitalization. Cord blood was collected at birth and tested with a positive result for SMA (0 copies of SMN1, 3 copies of SMN2). She received Onasemnogene Abeparvovec (OA) at 21 days after birth. She was floppy with delayed motor development, and began to walk with support at 1 year and 2 months, but with frequent falls. Comorbidities included scoliosis, lordosis, and clubfoot. After treatment, she began to walk (with falls), and disclosed tongue fasciculation, polyminimyoclonus of the upper limbs, and proximal weakness of the lower limbs. Risdiplam was started as a combination therapy. Patient B: A male diagnosed with SMA type 2 (SMN1: 0; SMN2: 3) began symptoms at 3 days after birth with hypotonia, sat at 8 months with support (never walked). OA was introduced, but he never walked, and was started on Risdiplam. Patient C: A 4-year-old male with SMA type 2 (SMN1: 0; SMN2: 3), received OA at 2 years old. At 3 years and 8 months, he did not acquire new motor milestones, never walked. Therefore, combined therapy with Risdiplam was introduced. Discussion: SMA is a treatable disease with three approved therapies in Brazil: Nusinersen, Risdiplam, OA. We report three patients with partially responsive or refractory to OA, requiring association with Risdiplam. FINAL CONSIDERATIONS: More data related to the combination of disease-modifying therapies in real-world scenarios are needed.

Open article ↗



2025-12-26 | Dutch rehabilitation physicians' perspectives on contracture management in children with spinal muscular atrophy: challenges in a changing landscape.

Many children with hereditary proximal spinal muscular atrophy (SMA) develop joint contractures. With the introduction of disease-modifying treatments (DMTs) for SMA, the improved functional prognosis may change the focus of (preventive) contracture management. This study aimed to describe current approaches to contracture management among Dutch pediatric rehabilitation physicians caring for children with SMA receiving DMT, and to explore the underlying considerations and clinical reasoning that inform their decisions on contracture management in the evolving therapeutic landscape. All registered pediatric rehabilitation physicians (n = 151) received a survey, addressing two main topics: (1) indication and purpose of contracture management, and (2) alignment of clinical decision-making with current guidelines. To this end, three standardized case scenarios were presented. Respondents were asked to indicate whether their current choices, were consistent with the guideline recommendations. To obtain a deeper understanding of the considerations and clinical reasoning regarding contracture management in the era of DMTs, we held an advisory group meeting. We audio-recorded the discussions and analyzed the content thematically. The response rate was 56%; 41 of these respondents were not involved in SMA care. 38 of the 44 surveys, completed by participants involved in SMA care, were suitable for analysis. All respondents (strongly) agreed about 'optimal sitting posture' being an important treatment goal, 95% agreed on 'pain prevention' and 87% on 'maintaining function'. Physicians recommended daily use of hand splints less frequently in children who started DMT before onset of symptoms (35%) than in children who started DMT at an advanced disease stage (54%). Thematic analysis revealed three themes shaping clinical reasoning: (1) functional prognosis as key element in decision-making; (2) clinical uncertainty regarding contracture intervention; and (3) incorporation of contextual factors. Dutch pediatric rehabilitation physicians describe challenges in clinical decision-making regarding contracture management in a changing landscape for SMA. The use of key principles could facilitate the process, including: (1) assessing the child's functional prognosis; (2) engaging in open discussions with parents about uncertainties arising from limited clinical experience and the evolving understanding of disease trajectories in the early post-DMT era; and (3) applying the ICF framework to incorporate contextual factors into clinical decision-making regarding contracture management.

Open article ↗



2026-07-19 | Real-world 12-month outcomes of Risdiplam in spinal muscular atrophy types 2 and 3: A Brazilian cohort.

Spinal Muscular Atrophy (SMA) is an autosomal recessive disorder characterized by progressive axial and proximal limb weakness, often leading to ventilatory insufficiency. Risdiplam, an oral SMN2 splicing modifier, has demonstrated efficacy across clinical trials involving both infantile and late-onset SMA. However, real-world data on its long-term safety and effectiveness remain limited. To evaluate the safety and preliminary efficacy of Risdiplam after one year of treatment in patients with SMA types 2 and 3. This retrospective, single-center study included patients with genetically confirmed SMA treated with Risdiplam at the Neuromuscular Clinic of the Hospital das Clínicas, University of São Paulo, Brazil. All participants were treatment-naïve before initiating Risdiplam and were followed for 12-months. Motor function (CHOP-INTEND, HFMS), pulmonary function (FVC, FEV₁), and necessity of G-tube were assessed at baseline, 6 m, and after one year of therapy. Sixteen patients were included (mean age 20-years, range 6-56). Eleven patients (69%) had SMA type 2, while 5 (31%) had SMA type 3. The mean untreated disease duration was 18-years (range 5-44). After 12-months, 13-patients (81%) showed apparent stabilization or improvement in motor function, while 3 (19%) exhibited motor decline. Pulmonary function improved or stabilized in 13 patients (81%) and declined in 3 (19%). Clinical decline was observed in patients with progressive scoliosis or overweight. All patients maintained exclusive oral feeding. Preliminary data from the one-year follow-up suggest that Risdiplam is safe and appears generally effective in preserving or enhancing motor, respiratory, and swallowing functions. Patients with severe skeletal deformities exhibited less favorable outcomes.

Open article ↗



2026-03-12 | A case of type 2 diabetes with spinal and bulbar muscular atrophy treated with oral semaglutide while sparing muscle reduction for two years: a case report with literature review.

Semaglutide has demonstrated beneficial effects in patients with type 2 diabetes; however, its long-term impact on skeletal muscle remains uncertain, particularly in individuals with multiple risk factors for muscle decline. We report a case of a 65-year-old man with type 2 diabetes who developed progressive proximal muscle weakness and was subsequently diagnosed with spinal and bulbar muscular atrophy (SBMA), for which leuprorelin therapy was initiated. Following treatment initiation, he exhibited worsened glycemic control, increased body weight and fat mass, along with reductions in both skeletal muscle mass and strength. At the age of 72, oral semaglutide was introduced. Over the following two years, improvements in glycemic parameters and reductions in fat mass were observed. Importantly, skeletal muscle mass and strength were relatively preserved, with only a minor annual decrease in muscle mass (- 0.1 kg/year), consistent with changes reported in previous studies of semaglutide-treated patients without neuromuscular conditions. To our knowledge, this is the first reported case describing the use of semaglutide in a patient with diabetes and SBMA under leuprorelin treatment, suggesting the potential utility of GLP-1 receptor agonists in managing metabolic parameters in individuals at high risk for muscle decline.

Open article ↗



2026-02-17 | Outcome of Pediatric Rehabilitation in SMA post gene therapy

Spinal muscular atrophy (SMA) is an autosomal recessive neuromuscular disorder marked by the degeneration of alpha motor neurons in the spinal cord, leading to progressive proximal muscle atrophy and paralysis. The incidence of SMA is notably higher in the Middle East compared to the Western world, partly due to the higher rates of consanguineous marriages in the region. Recent advances have introduced therapies such as Spinraza, Zolgensma, and Risdiplam which have been approved by the US Food and Drug Administration (FDA) and the European Medicines Agency (EMA). These treatments represent a significant shift from managing progressive neurodegeneration to achieving milder, chronic forms of the disease. The introduction of gene therapy has transformed SMA management, necessitating a comprehensive, multidisciplinary approach. This approach involves collaboration among healthcare professionals including pediatricians, neurologists, physical medicine specialists, pulmonologists, and rehabilitation experts, as well as therapists such as physical, occupational, and speech therapists and dietitians, with involving patients, caregivers, and families. This paper explores the role of rehabilitation in optimizing outcomes for pediatric SMA patients receiving gene therapy at Qatar Rehabilitation Institute. It aims to evaluate how early and comprehensive rehabilitation strategies can enhance the effectiveness of expensive interventions like gene therapy. A multidisciplinary team whose follow the standard of care ( practice guidelines for clinical care 2007-2018) at the Qatar Rehabilitation Institute provides long-term rehabilitation , integrated medical care for SMA patients post-gene therapy. This care includes positioning and bracing, supported standing, stretching, management of musculoskeletal deformities, physical exercise training (including aerobics, hydrotherapy and strengthening exercises), use of assistive devices, speech and dysphagia treatment. The study assesses the impact of these rehabilitation strategies on motor function, daily living activities, and overall quality of life. Rehabilitation play important role in improving motor function and daily performance like range of motion in SMA patients undergoing gene therapy. Early intervention and ongoing rehabilitation have contributed to better outcomes in terms of motor skills, activities of daily living, and quality of life. The shift to gene therapy necessitates an evolved approach to SMA management. Effective rehabilitation is crucial in maximizing the benefits of such costly treatments. This paper Describe improvement of SMA with intensive pediatric rehabilitation who received therapeutic intervention (gene therapy with or without Nusinersin ) in pediatric rehabilitation department in Qatar by monitoring in the score of CHOP INTENT tools / Hammersmith. This study is a retrospective observational study where data will be collected for about 18 children with SMA between age 0 to 14 years from period 01/06/2018 to 31/08/2024 who are followed up in SMA multidisciplinary clinic , Qatar Rehabilitation Institute.

Open article ↗



2026-01-16 | Three patients with spinal muscular atrophy who have switched treatments risdiplam following onasemnogene abeparvovec, case report

Introduction: 5q spinal muscular atrophy (SMA) is the most common motor neuron disease of childhood. Patients present with hypotonia, symmetrical proximal muscle weakness, and areflexia. Treatment responses are highly variable, even in patients treated with gene therapy approaches. CASE presentation: Patient A: A 4-year-old female was born healthy, needed no hospitalization. Cord blood was collected at birth and tested with a positive result for SMA (0 copies of SMN1, 3 copies of SMN2). She received Onasemnogene Abeparvovec (OA) at 21 days after birth. She was floppy with delayed motor development, and began to walk with support at 1 year and 2 months, but with frequent falls. Comorbidities included scoliosis, lordosis, and clubfoot. After treatment, she began to walk (with falls), and disclosed tongue fasciculation, polyminimyoclonus of the upper limbs, and proximal weakness of the lower limbs. Risdiplam was started as a combination therapy. Patient B: A male diagnosed with SMA type 2 (SMN1: 0; SMN2: 3) began symptoms at 3 days after birth with hypotonia, sat at 8 months with support (never walked). OA was introduced, but he never walked, and was started on Risdiplam. Patient C: A 4-year-old male with SMA type 2 (SMN1: 0; SMN2: 3), received OA at 2 years old. At 3 years and 8 months, he did not acquire new motor milestones, never walked. Therefore, combined therapy with Risdiplam was introduced. Discussion: SMA is a treatable disease with three approved therapies in Brazil: Nusinersen, Risdiplam, OA. We report three patients with partially responsive or refractory to OA, requiring association with Risdiplam. FINAL CONSIDERATIONS: More data related to the combination of disease-modifying therapies in real-world scenarios are needed.

Open article ↗



2025-12-26 | Dutch rehabilitation physicians' perspectives on contracture management in children with spinal muscular atrophy: challenges in a changing landscape.

Many children with hereditary proximal spinal muscular atrophy (SMA) develop joint contractures. With the introduction of disease-modifying treatments (DMTs) for SMA, the improved functional prognosis may change the focus of (preventive) contracture management. This study aimed to describe current approaches to contracture management among Dutch pediatric rehabilitation physicians caring for children with SMA receiving DMT, and to explore the underlying considerations and clinical reasoning that inform their decisions on contracture management in the evolving therapeutic landscape. All registered pediatric rehabilitation physicians (n = 151) received a survey, addressing two main topics: (1) indication and purpose of contracture management, and (2) alignment of clinical decision-making with current guidelines. To this end, three standardized case scenarios were presented. Respondents were asked to indicate whether their current choices, were consistent with the guideline recommendations. To obtain a deeper understanding of the considerations and clinical reasoning regarding contracture management in the era of DMTs, we held an advisory group meeting. We audio-recorded the discussions and analyzed the content thematically. The response rate was 56%; 41 of these respondents were not involved in SMA care. 38 of the 44 surveys, completed by participants involved in SMA care, were suitable for analysis. All respondents (strongly) agreed about 'optimal sitting posture' being an important treatment goal, 95% agreed on 'pain prevention' and 87% on 'maintaining function'. Physicians recommended daily use of hand splints less frequently in children who started DMT before onset of symptoms (35%) than in children who started DMT at an advanced disease stage (54%). Thematic analysis revealed three themes shaping clinical reasoning: (1) functional prognosis as key element in decision-making; (2) clinical uncertainty regarding contracture intervention; and (3) incorporation of contextual factors. Dutch pediatric rehabilitation physicians describe challenges in clinical decision-making regarding contracture management in a changing landscape for SMA. The use of key principles could facilitate the process, including: (1) assessing the child's functional prognosis; (2) engaging in open discussions with parents about uncertainties arising from limited clinical experience and the evolving understanding of disease trajectories in the early post-DMT era; and (3) applying the ICF framework to incorporate contextual factors into clinical decision-making regarding contracture management.

Open article ↗



Access all drug discovery papers and probability of success in trials forecasts:

Access all drug discovery papers and probability of success in trials forecasts:

Drug Discovery Landscape

40 orphan drug designations for Proximal spinal muscular atrophy, including 6 approved therapies.

40 orphan drug designations for Proximal spinal muscular atrophy, including 6 approved therapies.

Drug

Therapy type

Regulator

Orphan designation

Approval

Sponsor

self-complementary recombinant adeno-associated viral vector (scAAV) containing a single-stranded transgene encoding a codon-optimized human SMN1 gene

gene therapies

FDA

2025-11-10

Beijing Genecradle Therapeutics Co., Ltd.

Emugrobart

antibodies

EMA

2025-08-22

Roche Registration GmbH

pegylated insulin-like growth factor 1 (PEG-IGF1)

proteins

FDA

2025-07-23

Sarcomed AB

Humanised IgG1 monoclonal antibody against muscle specific kinase

antibodies

EMA

2025-04-16

Argenx

antisense oligonucleotide (ASO) binding SMN2 pre-mRNA

oligonucleotides

FDA

2024-01-22

Biogen

Taldefgrobep alfa

antibodies

EMA

2023-07-25

Biohaven Bioscience Ireland Limited

Taldefgrobep Alfa

proteins

FDA

2022-12-16

Biohaven Pharmaceuticals, Inc.

recombinant humanized IgG1-based monoclonal antibody which binds to human latent myostatin in a pH dependent manner

antibodies

FDA

2021-12-07

Genentech Inc.

Phosphorodiamidate morpholino oligomer (5¿- CTATATATAGTTATTCAACA -3¿)

oligonucleotides

FDA

2020-03-04

Shift Pharmaceuticals Holdings, Inc.

Reldesemtiv

small molecules

EMA

2019-06-28

Cytokinetics (Ireland) Limited

Risdiplam [Evrysdi]

small molecules

EMA

2019-02-26

Roche Registration GmbH

Human anti-promyostatin monoclonal antibody

antibodies

EMA

2018-12-14

Scholar Rock Netherlands B.V.

Adeno-associated viral vector serotype hu68 containing the human SMN1 gene

gene therapies

EMA

2018-08-24

Biogen Netherlands B.V.

recombinant adeno-associated viral vector containing a single-stranded transgene encoding a codon-optimized human SMN1 complementary deoxyribonucleic acid under the control of the chicken beta actin promoter

gene therapies

FDA

2018-07-16

Biogen Inc.

Brinretigene vesgedparvovec

gene therapies

EMA

2018-04-16

Novartis Europharm Limited

fully human anti-proMyostatin monoclonal antibody of the IgG4/lambda isotype that binds to human pro- and latent myostatin with high affinity

antibodies

FDA

2018-03-22

Scholar Rock

branaplam

small molecules

FDA

2018-01-23

Novartis Pharmaceuticals Corporation

fast skeletal muscle troponin activator

small molecules

FDA

2017-05-11

Cytokinetics, Inc.

risdiplam [Evrysdi]

small molecules

FDA

2017-01-04

2020-08-07

Genentech, Inc., a Member of the Roche Group

Adeno-associated viral vector serotype 9 containing the human SMN gene [Zolgensma]

gene therapies

EMA

2015-06-19

2020-05-18

Novartis Europharm Limited

onasemnogene abeparvovec [ZOLGENSMA]

gene therapies

FDA

2014-09-30

2019-05-24

Novartis Gene Therapies, Inc.

onasemnogene abeparvovec-brve [Itvisma]

gene therapies

FDA

2014-09-30

2025-11-24

Novartis Gene Therapies, Inc.

5-[1-(2,6-dichlorobenzyl)piperidin-4-ylmethoxy]quinazoline-2,4-diamine dihydrochloride

small molecules

EMA

2013-06-07

Sirius Regulatory Consulting Limited

Allogeneic motor neuron progenitor cells derived from human embryonic stem cells

cell therapies

EMA

2013-01-24

California Stem Cell (UK) Ltd

Antisense oligonucleotide targeted to the SMN2 gene [Spinraza]

oligonucleotides

EMA

2012-04-02

2017-06-01

Biogen Netherlands B.V.

Sodium phenylbutyrate

small molecules

EMA

2012-01-11

[INACTIVE] Orphalan

sodium 4-phenylbutyrate

small molecules

FDA

2011-10-18

GMP-Orphan SAS

5-[1-(2,6-dichlorobenzyl)piperidin-4-ylmethoxy]quinazoline-2,4-diamine dihydrochloride

small molecules

EMA

2011-08-30

Repligen Europe Limited

Viral vector containing DNA encoding the human SMN protein

gene therapies

EMA

2011-06-21

University of Sheffield

nusinersen [Spinraza]

oligonucleotides

FDA

2011-04-18

2016-12-23

Biogen, Inc

late stage human motor neutron progenitors

RNAs

FDA

2009-11-25

Caladrius Biosciences

5-[1-(2,6-Dichlorobenzyl)-piperidin-4-yl]methoxyquinazoline-2,4-diamine

small molecules

FDA

2009-08-25

CureSMA

cholest-4-en-3-one, oxime

small molecules

FDA

2009-02-17

Genentech, Inc.

ataluren

small molecules

FDA

2008-03-10

PTC Therapeutics, Inc.

Sodium phenylbutyrate

small molecules

FDA

2007-03-20

Tikvah Therapeutics, Inc.

Sodium phenylbutyrate

small molecules

FDA

2007-01-25

OrphaMed, Inc.

Sodium valproate [Project Butterfly]

small molecules

EMA

2005-08-26

[INACTIVE] The Jennifer Trust For Spinal Muscular Atrophy Limited

Glyceryl tri (4-phenylbutyrate)

small molecules

FDA

2005-05-24

Ucyclyd Pharma, Inc

Olesoxime

small molecules

EMA

2005-03-10

Roche Registration GmbH

Ciliary neurotrophic factor, recombinant human

proteins

FDA

1992-04-02

Syntex-Synergen Neuroscience

Explority AI logo

228 Park Ave S,
New York, USA.

At Explority, we build first-of-its-kind AI to bring clarity to the earliest and riskiest stages of pharmaceutical research by forecasting which therapies are most likely to succeed. Explority AI web and mobile applications are properties of the Explority AI Inc., a company registered in the United States (File No. 10320493).
For all questions: support@explority.ai

Copyright © 2026 Explority AI Inc.

Explority AI logo

228 Park Ave S,
New York, USA.

At Explority, we build first-of-its-kind AI to bring clarity to the earliest and riskiest stages of pharmaceutical research by forecasting which therapies are most likely to succeed. Explority AI web and mobile applications are properties of the Explority AI Inc., a company registered in the United States (File No. 10320493).
For all questions: support@explority.ai

Copyright © 2026 Explority AI Inc.

Explority AI logo

228 Park Ave S,
New York, USA.

At Explority, we build first-of-its-kind AI to bring clarity to the earliest and riskiest stages of pharmaceutical research by forecasting which therapies are most likely to succeed. Explority AI web and mobile applications are properties of the Explority AI Inc., a company registered in the United States (File No. 10320493).
For all questions: support@explority.ai

Copyright © 2026 Explority AI Inc.