RARE DISEASE
Retinopathy of prematurity
Retinopathy of prematurity
Retinopathy of prematurity
Synonyms: ROP, Retrolental fibroplasia
Synonyms: ROP, Retrolental fibroplasia
Synonyms: ROP, Retrolental fibroplasia
Drug discovery
21
drugs
With orphan designations
Overview
Retinopathy of prematurity (ROP) is a retinal vascular disorder affecting premature infants, particularly those born before 31 weeks gestation or weighing <1500g. Abnormal blood vessel proliferation can lead to retinal detachment and blindness if untreated. While 90% of cases resolve spontaneously, severe ROP (stages 3-5) requires intervention. Screening protocols recommend initial ophthalmologic exams 4-6 weeks postnatally for at-risk infants, with close monitoring until retinal vascularization completes. [1][2][6]
Therapies
Categories: rare ophthalmic disorders
Research Papers
3,147 drug discovery papers about Retinopathy of prematurity, with 5 first-in-class and 26 next-in-class emerging drug candidates forecasted to outperform the average preclinical success rate. Recent publications:
3,147 drug discovery papers about Retinopathy of prematurity, with 5 first-in-class and 26 next-in-class emerging drug candidates forecasted to outperform the average preclinical success rate. Recent publications:
2026-08-12 | Association of antenatal corticosteroid therapy on women with clinical chorioamnionitis: A nationwide cohort study in Japan.
Antenatal corticosteroids (ACS) prevent neonatal complications and mortality in women at risk of preterm birth. However, the benefits and risks of ACS in chorioamnionitis (CAM) remain debated. This study evaluated whether ACS in women with clinical CAM was associated with adverse neonatal outcomes. This population-based retrospective study included neonates born before 34 weeks of gestation to women with clinical CAM in Japan between April 2010 and March 2023. Data were obtained from the Neonatal Research Network of Japan database. Adjusted odds ratios (aOR) for mortality and morbidity were compared between ACS and non-ACS groups. Of the 6,158 preterm infants born to mothers with clinical CAM, 4,086 (66.4%) received ACS and 2,072 (33.6%) did not. ACS exposure was associated with reduced aORs for respiratory distress syndrome (RDS; aOR: 0.85; 95% confidence interval [CI]: 0.75-0.96), intraventricular hemorrhage (IVH) grade III/IV (aOR: 0.52; 95% CI: 0.41-0.66), periventricular leukomalacia (PVL; aOR: 0.71; 95% CI: 0.54-0.95), sepsis (aOR: 0.78; 95% CI: 0.66-0.92), treated retinopathy of prematurity (ROP; aOR: 0.81; 95% CI: 0.69-0.95), and mortality (aOR: 0.69; 95% CI: 0.55-0.87). In contrast, the aOR for bronchopulmonary dysplasia (BPD) was higher in the ACS group (aOR: 1.51; 95% CI: 1.31-1.73). ACS treatment in women with clinical CAM was associated with reduced neonatal death, RDS, severe IVH, PVL, sepsis, and ROP while increasing the risk of BPD. These findings support ACS therapy while underscoring the need for further studies to identify interventions beyond ACS to prevent BPD.
2026-08-08 | Network Pharmacology and Experimental Validation Elucidate the Anti-Angiogenic Mechanism of Silibinin.
Retinopathy of prematurity (ROP) is a sight-threatening vascular disorder driven by pathological neovascularization. Silibinin (SIL), a major flavonolignan from milk thistle, possesses antioxidant and anti-inflammatory properties. Mechanistically, its therapeutic effect arises from attenuated oxidative stress, which suppresses mitogen-activated protein kinase (MAPK) signaling upstream. This study employed an integrated network pharmacology and experimental strategy to elucidate SIL's antiangiogenic mechanism. Network analysis identified the MAPK pathway as a key target, and topological analysis highlighted core associated proteins (KDR, ABCB1, and MMP2). Subsequent in vitro experiments using human umbilical vein endothelial cells (HUVECs) showed that SIL (at concentrations of 10 and 20 µM) significantly inhibited hypoxia-induced MAPK pathway activation (reducing phosphorylation of p38, ERK, and JNK) and downregulated KDR expression. SIL treatment dose-dependently suppressed endothelial cell proliferation, migration, and tube formation under hypoxic conditions. In an oxygen-induced retinopathy (OIR) mouse model, in vivo administration of SIL (at a dose of 100 mg/kg) reduced pathological retinal neovascularization (RNV) by ∼57.6% and the avascular area by ∼27.2%. (p < 0.01 and p < 0.05, respectively). These findings demonstrate that SIL inhibits pathological retinal angiogenesis primarily by modulating the MAPK pathway, providing mechanistic insight and highlighting its potential as a multi-target therapeutic candidate for ROP.
2026-08-04 | Retinopathy of prematurity epidemiology and treatment trend in a tertiary medical center in Taiwan: From 2016 to 2023.
To investigate the recent 8-year epidemiology of retinopathy of prematurity (ROP) and treatment modalities in Taiwan. A retrospective study was conducted from 2016 to 2023, using data from Chang Gung Memorial Hospital, Linkou, Taiwan, and enrolling 2078 premature babies who were screened for ROP. The incidence of ROP, type 1 ROP, and initial treatment were analyzed. ROP developed in 671 of the 2078 infants (29.7%), and type 1 ROP was present in 195 infants (9.4%). A declining trend was observed in the number of ROP screenings among premature infants (P = 0.02). The proportion of type 1 ROP decreased significantly from 12.13% in 2016 to 5.0% in 2023 (P < 0.01). Antivascular endothelial growth factor (VEGF) was chosen in 97% and 93.2% of the initial and overall treatments, respectively, with laser mainly used as a secondary treatment. Bevacizumab was the most frequently selected option among the three available anti-VEGF drugs. The incidence of ROP between 2016 and 2023 showed no significant change. The proportion of type 1 ROP decreased during this period. Anti-VEGF was chosen as the initial treatment, and bevacizumab was the most frequently used agent.
2026-08-03 | [Tetramethylpyrazine inhibits neovascularization in oxygen-induced retinopathy based on microglial polarization].
Neovascular eye diseases are a major cause of blindness, primarily proliferative diabetic retinopathy and retinopathy of prematurity, and the latter is the leading cause of blindness due to neovascular eye diseases in children. Laser ablation and intravitreal anti-vascular endothelial growth factor(VEGF) injections are currently effective treatments for retinal neovascularization, but they have certain limitations. In some patients, escape from VEGF signaling may occur, presenting as secondary drug resistance or non-response to therapy, so searching for new therapeutic strategies is necessary. This study aimed to investigate the effects of tetramethylpyrazine(TMP) on retinal neovascularization based on microglial polarization and to explore its mechanism of action. In this experiment, a mouse model of oxygen-induced retinopathy(OIR) was used. From postnatal day 12 to postnatal day 16, TMP was administered via intraperitoneal injection for intervention and treatment. The model was verified through methods such as fundus fluorescein angiography and retinal flat-mount staining. The research showed that intraperitoneal injection of TMP in the OIR model reduced pathological angiogenesis and improved the area of avascular zones. TMP modulated the polarization of proinflammatory microglia to anti-inflammatory microglia. Additionally, TMP decreased the expression of the inflammatory cytokine tumor necrosis factor-α(TNF-α) in OIR retinas and reversed the expression levels of the anti-inflammatory cytokine interleukin-10(IL-10). Mechanistically, TMP downregulated the phosphorylation levels of the phosphatidylinositol 3-kinase(PI3K)/protein kinase B(AKT)/mammalian target of rapamycin(mTOR) signaling pathway, and changes in the phosphorylation level of this pathway can affect the expression of related proteins, thereby regulating the functional state of microglia and facilitating the recovery of resident microglia, accompanied by a reduction in macrophage infiltration. The results suggest that TMP has anti-angiogenic and anti-inflammatory effects in OIR mice by inhibiting the PI3K/AKT/mTOR pathway and promoting the polarization of microglia toward an anti-inflammatory phenotype. These findings suggest its therapeutic potential in treating neovascular retinal diseases.
2026-08-03 | Dexamethasone Eye Drops to Prevent Treatment-Requiring Retinopathy of Prematurity: The DROPROP Randomized Clinical Trial.
Current treatment for type 1 retinopathy of prematurity (ROP), including laser photocoagulation and intravitreal anti-vascular endothelial growth factor therapy, is invasive but necessary to prevent blindness. Experimental evidence and limited clinical experience suggest that topical steroids may reduce disease progression and the need for invasive treatment. To evaluate whether dexamethasone eye drops reduce the proportion of preterm infants with prethreshold ROP progressing to treatment-requiring type 1 ROP. The DROPROP trial was a double-masked randomized clinical trial at 6 university hospitals and 8 county hospitals in Sweden. It evaluated infants born before 30 weeks' gestational age (GA), from 2022 to 2025, with severe ROP. Data analysis was performed from November 2025 to January 2026. Infants were randomized to receive dexamethasone eye drops (1 mg/mL) or placebo (saline). One eye drop was administered every day or every other day for up to 12 weeks. The primary outcome was progression to type 1 ROP requiring invasive treatment. Logistic regression adjusted for GA and site was used for the primary analysis. Intention-to-treat analysis was performed. Adverse events were monitored as safety outcomes. Among 100 infants, the mean (SD) GA at birth was 25.1 (1.4) weeks, 42 (42.0%) were female, and the mean (SD) birth weight was 712.9 (202.1) g. In the intention-to-treat population, type 1 ROP occurred in 10 of 50 infants (20.0%) in the dexamethasone group and 19 of 50 infants (38.0%) in the placebo group (adjusted odds ratio, 0.44; 95% CI, 0.17-1.12; P = .08), corresponding to a relative risk reduction of 47%. In the per-protocol population, type 1 ROP occurred in 9 of 48 infants (18.8%) in the dexamethasone group vs 19 of 49 infants (38.8%) in the placebo group (adjusted odds ratio, 0.40; 95% CI 0.15-1.05). No clinically significant differences in adverse events were observed between groups. Timely administration of topical dexamethasone numerically reduced the risk of prethreshold ROP progressing to treatment-requiring type 1 ROP. Although the analysis did not reach statistical significance, these findings suggest that topical dexamethasone may be a safe, noninvasive strategy to reduce the need for invasive treatment. euclinicaltrials.eu Identifier: 2023-505318-97-00.
2026-08-12 | Association of antenatal corticosteroid therapy on women with clinical chorioamnionitis: A nationwide cohort study in Japan.
Antenatal corticosteroids (ACS) prevent neonatal complications and mortality in women at risk of preterm birth. However, the benefits and risks of ACS in chorioamnionitis (CAM) remain debated. This study evaluated whether ACS in women with clinical CAM was associated with adverse neonatal outcomes. This population-based retrospective study included neonates born before 34 weeks of gestation to women with clinical CAM in Japan between April 2010 and March 2023. Data were obtained from the Neonatal Research Network of Japan database. Adjusted odds ratios (aOR) for mortality and morbidity were compared between ACS and non-ACS groups. Of the 6,158 preterm infants born to mothers with clinical CAM, 4,086 (66.4%) received ACS and 2,072 (33.6%) did not. ACS exposure was associated with reduced aORs for respiratory distress syndrome (RDS; aOR: 0.85; 95% confidence interval [CI]: 0.75-0.96), intraventricular hemorrhage (IVH) grade III/IV (aOR: 0.52; 95% CI: 0.41-0.66), periventricular leukomalacia (PVL; aOR: 0.71; 95% CI: 0.54-0.95), sepsis (aOR: 0.78; 95% CI: 0.66-0.92), treated retinopathy of prematurity (ROP; aOR: 0.81; 95% CI: 0.69-0.95), and mortality (aOR: 0.69; 95% CI: 0.55-0.87). In contrast, the aOR for bronchopulmonary dysplasia (BPD) was higher in the ACS group (aOR: 1.51; 95% CI: 1.31-1.73). ACS treatment in women with clinical CAM was associated with reduced neonatal death, RDS, severe IVH, PVL, sepsis, and ROP while increasing the risk of BPD. These findings support ACS therapy while underscoring the need for further studies to identify interventions beyond ACS to prevent BPD.
2026-08-08 | Network Pharmacology and Experimental Validation Elucidate the Anti-Angiogenic Mechanism of Silibinin.
Retinopathy of prematurity (ROP) is a sight-threatening vascular disorder driven by pathological neovascularization. Silibinin (SIL), a major flavonolignan from milk thistle, possesses antioxidant and anti-inflammatory properties. Mechanistically, its therapeutic effect arises from attenuated oxidative stress, which suppresses mitogen-activated protein kinase (MAPK) signaling upstream. This study employed an integrated network pharmacology and experimental strategy to elucidate SIL's antiangiogenic mechanism. Network analysis identified the MAPK pathway as a key target, and topological analysis highlighted core associated proteins (KDR, ABCB1, and MMP2). Subsequent in vitro experiments using human umbilical vein endothelial cells (HUVECs) showed that SIL (at concentrations of 10 and 20 µM) significantly inhibited hypoxia-induced MAPK pathway activation (reducing phosphorylation of p38, ERK, and JNK) and downregulated KDR expression. SIL treatment dose-dependently suppressed endothelial cell proliferation, migration, and tube formation under hypoxic conditions. In an oxygen-induced retinopathy (OIR) mouse model, in vivo administration of SIL (at a dose of 100 mg/kg) reduced pathological retinal neovascularization (RNV) by ∼57.6% and the avascular area by ∼27.2%. (p < 0.01 and p < 0.05, respectively). These findings demonstrate that SIL inhibits pathological retinal angiogenesis primarily by modulating the MAPK pathway, providing mechanistic insight and highlighting its potential as a multi-target therapeutic candidate for ROP.
2026-08-04 | Retinopathy of prematurity epidemiology and treatment trend in a tertiary medical center in Taiwan: From 2016 to 2023.
To investigate the recent 8-year epidemiology of retinopathy of prematurity (ROP) and treatment modalities in Taiwan. A retrospective study was conducted from 2016 to 2023, using data from Chang Gung Memorial Hospital, Linkou, Taiwan, and enrolling 2078 premature babies who were screened for ROP. The incidence of ROP, type 1 ROP, and initial treatment were analyzed. ROP developed in 671 of the 2078 infants (29.7%), and type 1 ROP was present in 195 infants (9.4%). A declining trend was observed in the number of ROP screenings among premature infants (P = 0.02). The proportion of type 1 ROP decreased significantly from 12.13% in 2016 to 5.0% in 2023 (P < 0.01). Antivascular endothelial growth factor (VEGF) was chosen in 97% and 93.2% of the initial and overall treatments, respectively, with laser mainly used as a secondary treatment. Bevacizumab was the most frequently selected option among the three available anti-VEGF drugs. The incidence of ROP between 2016 and 2023 showed no significant change. The proportion of type 1 ROP decreased during this period. Anti-VEGF was chosen as the initial treatment, and bevacizumab was the most frequently used agent.
2026-08-03 | [Tetramethylpyrazine inhibits neovascularization in oxygen-induced retinopathy based on microglial polarization].
Neovascular eye diseases are a major cause of blindness, primarily proliferative diabetic retinopathy and retinopathy of prematurity, and the latter is the leading cause of blindness due to neovascular eye diseases in children. Laser ablation and intravitreal anti-vascular endothelial growth factor(VEGF) injections are currently effective treatments for retinal neovascularization, but they have certain limitations. In some patients, escape from VEGF signaling may occur, presenting as secondary drug resistance or non-response to therapy, so searching for new therapeutic strategies is necessary. This study aimed to investigate the effects of tetramethylpyrazine(TMP) on retinal neovascularization based on microglial polarization and to explore its mechanism of action. In this experiment, a mouse model of oxygen-induced retinopathy(OIR) was used. From postnatal day 12 to postnatal day 16, TMP was administered via intraperitoneal injection for intervention and treatment. The model was verified through methods such as fundus fluorescein angiography and retinal flat-mount staining. The research showed that intraperitoneal injection of TMP in the OIR model reduced pathological angiogenesis and improved the area of avascular zones. TMP modulated the polarization of proinflammatory microglia to anti-inflammatory microglia. Additionally, TMP decreased the expression of the inflammatory cytokine tumor necrosis factor-α(TNF-α) in OIR retinas and reversed the expression levels of the anti-inflammatory cytokine interleukin-10(IL-10). Mechanistically, TMP downregulated the phosphorylation levels of the phosphatidylinositol 3-kinase(PI3K)/protein kinase B(AKT)/mammalian target of rapamycin(mTOR) signaling pathway, and changes in the phosphorylation level of this pathway can affect the expression of related proteins, thereby regulating the functional state of microglia and facilitating the recovery of resident microglia, accompanied by a reduction in macrophage infiltration. The results suggest that TMP has anti-angiogenic and anti-inflammatory effects in OIR mice by inhibiting the PI3K/AKT/mTOR pathway and promoting the polarization of microglia toward an anti-inflammatory phenotype. These findings suggest its therapeutic potential in treating neovascular retinal diseases.
2026-08-03 | Dexamethasone Eye Drops to Prevent Treatment-Requiring Retinopathy of Prematurity: The DROPROP Randomized Clinical Trial.
Current treatment for type 1 retinopathy of prematurity (ROP), including laser photocoagulation and intravitreal anti-vascular endothelial growth factor therapy, is invasive but necessary to prevent blindness. Experimental evidence and limited clinical experience suggest that topical steroids may reduce disease progression and the need for invasive treatment. To evaluate whether dexamethasone eye drops reduce the proportion of preterm infants with prethreshold ROP progressing to treatment-requiring type 1 ROP. The DROPROP trial was a double-masked randomized clinical trial at 6 university hospitals and 8 county hospitals in Sweden. It evaluated infants born before 30 weeks' gestational age (GA), from 2022 to 2025, with severe ROP. Data analysis was performed from November 2025 to January 2026. Infants were randomized to receive dexamethasone eye drops (1 mg/mL) or placebo (saline). One eye drop was administered every day or every other day for up to 12 weeks. The primary outcome was progression to type 1 ROP requiring invasive treatment. Logistic regression adjusted for GA and site was used for the primary analysis. Intention-to-treat analysis was performed. Adverse events were monitored as safety outcomes. Among 100 infants, the mean (SD) GA at birth was 25.1 (1.4) weeks, 42 (42.0%) were female, and the mean (SD) birth weight was 712.9 (202.1) g. In the intention-to-treat population, type 1 ROP occurred in 10 of 50 infants (20.0%) in the dexamethasone group and 19 of 50 infants (38.0%) in the placebo group (adjusted odds ratio, 0.44; 95% CI, 0.17-1.12; P = .08), corresponding to a relative risk reduction of 47%. In the per-protocol population, type 1 ROP occurred in 9 of 48 infants (18.8%) in the dexamethasone group vs 19 of 49 infants (38.8%) in the placebo group (adjusted odds ratio, 0.40; 95% CI 0.15-1.05). No clinically significant differences in adverse events were observed between groups. Timely administration of topical dexamethasone numerically reduced the risk of prethreshold ROP progressing to treatment-requiring type 1 ROP. Although the analysis did not reach statistical significance, these findings suggest that topical dexamethasone may be a safe, noninvasive strategy to reduce the need for invasive treatment. euclinicaltrials.eu Identifier: 2023-505318-97-00.
Access all drug discovery papers and probability of success in trials forecasts:
Access all drug discovery papers and probability of success in trials forecasts:
Drug Discovery Landscape
21 orphan drug designations for Retinopathy of prematurity, including 2 approved therapies.
21 orphan drug designations for Retinopathy of prematurity, including 2 approved therapies.
Drug | Therapy type | Regulator | Orphan designation | Approval | Sponsor |
|---|---|---|---|---|---|
31-amino acid TREM-1 inhibitory peptide | peptides | FDA | 2026-03-22 | — | SignaBlok, Inc. |
methyldopa | small molecules | FDA | 2024-02-27 | — | FELIQS Corporation |
Arginyl-Glutamine Dipeptide | small molecules | FDA | 2022-09-20 | — | Infant Bacterial Therapeutics AB |
Sodium (4Z,7Z,10R,11E,13E,15Z,17S,19Z)10,17-dihydroxy-docosa-4,7,11,13,15,19-hexaenoate | small molecules | EMA | 2022-06-21 | — | Granzer Regulatory Consulting & Services GmbH |
Human Insulin (rDNA) | proteins | FDA | 2022-02-28 | — | Elgan Pharma, Ltd. |
Insulin human | peptides | EMA | 2022-01-14 | — | Sirius Regulatory Consulting EU Limited |
Melatonin | small molecules | EMA | 2021-06-21 | — | Worphmed S.r.l. |
Melatonin | small molecules | FDA | 2020-04-20 | — | WORPHMED Srl |
Melatonin | small molecules | FDA | 2020-04-20 | — | WORPHMED Srl |
Sodium (4Z,7Z,10R,11E,13E,15Z,17S,19Z) 10,17-dihydroxy-docosa-4,7,11,13,15,19-hexaenoate | small molecules | FDA | 2020-03-30 | — | Anida Pharma Inc. |
Propranolol hydrochloride | small molecules | EMA | 2019-10-17 | — | Recordati Rare Diseases |
Propranolol | small molecules | FDA | 2019-08-23 | — | Recordati Rare Diseases, SARL |
aflibercept [Eylea] | proteins | FDA | 2019-07-23 | 2023-02-08 | Regeneron Pharmaceuticals, Inc. |
Retinol | small molecules | EMA | 2017-07-17 | — | Orphanix GmbH |
retinol palmitate (vitamin A palmitate) | small molecules | FDA | 2017-06-28 | — | orphanix GmbH |
3-[3-(6-guanidino-1-oxoisoindolin-2yl) propanamido]-3-(pyridine-3yl) propanoic acid dihydrochloride | small molecules | FDA | 2017-01-17 | — | Advanced Imaging Projects, LLC |
mecasermin rinfabate | proteins | FDA | 2012-09-20 | — | OHB Neonatology Ltd |
hydroxyprogesterone caproate [Makena] | — | FDA | 2007-01-25 | 2011-02-03 | AMAG Pharma USA, Inc. |
Mecasermin rinfabate | proteins | EMA | 2006-08-28 | — | Orphix Consulting GmbH |
myo-inositol | small molecules | FDA | 2005-04-07 | — | Abbott Nutrition |
Antisense Oligonucleotide (TATCCGGAGGGCTCGCCATGCTGCT) | oligonucleotides | EMA | 2003-10-02 | — | Gene Signal SAS |
Let's accelerate rare disease drug discovery
Let's accelerate drug discovery
Get access to Explority AI's forecasts to outperform average preclinical success rates. Whether you're expanding your R&D pipeline, evaluating a partnership, or simply have a question — we'd love to hear from you.