RARE DISEASE
Retinopathy of prematurity
Retinopathy of prematurity
Retinopathy of prematurity
Synonyms: ROP, Retrolental fibroplasia
Synonyms: ROP, Retrolental fibroplasia
Synonyms: ROP, Retrolental fibroplasia
Drug discovery
21
drugs
With orphan designations
Overview
Retinopathy of prematurity (ROP) is a retinal vascular disorder affecting premature infants, particularly those born before 31 weeks gestation or weighing <1500g. Abnormal blood vessel proliferation can lead to retinal detachment and blindness if untreated. While 90% of cases resolve spontaneously, severe ROP (stages 3-5) requires intervention. Screening protocols recommend initial ophthalmologic exams 4-6 weeks postnatally for at-risk infants, with close monitoring until retinal vascularization completes. [1][2][6]
Therapies
Categories: rare ophthalmic disorders
Research Papers
3,171 drug discovery papers about Retinopathy of prematurity, with 5 first-in-class and 24 next-in-class emerging drug candidates forecasted to outperform the average preclinical success rate. Recent publications:
3,171 drug discovery papers about Retinopathy of prematurity, with 5 first-in-class and 24 next-in-class emerging drug candidates forecasted to outperform the average preclinical success rate. Recent publications:
categories:
Small molecules
small molecules
2026-09-29 | Intratracheal budesonide combined with surfactant for respiratory distress syndrome in preterm infants: A randomized clinical trial.
BackgroundBronchopulmonary dysplasia (BPD) remains a major cause of morbidity among preterm infants with respiratory distress syndrome (RDS). Intratracheal budesonide combined with surfactant may reduce pulmonary inflammation and improve neonatal outcomes.MethodsIn this randomized clinical trial, 160 preterm infants (gestational age 26-32 weeks; birth weight <1500 g) requiring surfactant therapy for RDS were assigned to receive either surfactant alone (n = 80) or surfactant plus budesonide (0.25 mg/kg; n = 80). Primary outcomes were oxygen dependency or respiratory support beyond 21 days of life (the prespecified study respiratory outcome) and in-hospital mortality. Secondary outcomes included sepsis, intraventricular hemorrhage, necrotizing enterocolitis, retinopathy of prematurity, respiratory support duration, and repeat surfactant administration.ResultsBaseline characteristics were comparable between groups. The primary respiratory outcome occurred in 16/80 infants (20.0%) in the budesonide-surfactant group and 26/80 infants (32.5%) in the surfactant-alone group (absolute risk difference -12.5 percentage points; P = 0.105). Mortality was significantly lower in the combination group (1.2% vs 11.2%, P = 0.018), as was culture-proven sepsis (5.0% vs 21.2%, P = 0.004). Infants receiving budesonide required fewer repeat surfactant doses (38.8% vs 61.3%, P = 0.016) and had a shorter duration of nasal continuous positive airway pressure support (10.1 ± 6.0 vs 17.9 ± 11.3 days, P = 0.001). The composite outcome of death or oxygen dependency/respiratory support beyond 21 days of life occurred in 35 infants (43.8%) in the control group and 17 infants (21.3%) in the combination group (P = 0.003).ConclusionsIn preterm infants with RDS, budesonide-surfactant therapy was associated with reduced mortality, sepsis, respiratory support duration, and repeat surfactant use. Although fewer infants in the intervention group met the prespecified respiratory outcome, the difference was not statistically significant. Larger multicenter trials using contemporary BPD definitions and incorporating long-term neurodevelopmental follow-up are needed before efficacy and safety can be established.
2026-09-23 | The CD39-CD73-adenosine axis: a pivotal regulator of retinal homeostasis and diseases.
Extracellular purinergic signaling, mediated by nucleotides such as adenosine triphosphate (ATP) and adenosine, is a critical regulator of retinal homeostasis. Within the retina, this signaling pathway is indispensable for maintaining physiological functions. Dysregulation of extracellular purine balance is a key driver of retinal pathophysiology, contributing to inflammation, pathological angiogenesis, and neurodegeneration in diseases like diabetic retinopathy (DR), age-related macular degeneration (AMD), glaucoma, and retinopathy of prematurity (ROP). The hydrolysis of extracellular ATP to adenosine, primarily orchestrated by the sequential actions of NTPDase1/ENTPD1 (CD39) and ecto-5'-nucleotidase/NT5E (CD73), represents a fundamental mechanism for calibrating purinergic signals and shifting the microenvironment from pro-inflammatory to anti-inflammatory and protective. CD39 and CD73 are pivotal enzymes in regulating retinal purinergic equilibrium. Despite their well-characterized roles in tumor biology and cerebral pathophysiology, the expression, physiological functions, and pathological implications of CD39/CD73 in the retina remain understudied and lack systematic synthesis. This review synthesizes current understanding of the roles of CD39 and CD73 in retinal physiology and pathology, with a focus on their implications in DR, AMD, glaucoma, and ROP. Critically, this review provides the first systematic integration of their layer-specific spatial compartmentalization, context-dependent functional duality, and emerging metabolic roles in photoreceptor homeostasis. We also discuss emerging therapeutic strategies that target this pathway, addressing the growing need for translational research to preserve vision.
2026-09-22 | Ceapin-A7 Suppresses UPR Signaling and Mitigates Retinal Neovascularization in Vldlr-/- Mice.
Pathological neovascularization drives blinding retinal diseases, including diabetic retinopathy, retinopathy of prematurity, and neovascular age-related macular degeneration. Endoplasmic reticulum (ER) stress and unfolded protein response (UPR) signaling are key mechanisms underlying neovascularization. Mice lacking the UPR regulator Activating Transcription Factor 6 (ATF6) show normal retinal vasculature yet are resistant to pathologic neovascularization, suggesting that ATF6 inhibition may mitigate retinal damage and vision loss from aberrant retinal angiogenesis. We tested Ceapin-A7, a selective ATF6 inhibitor, in Vldlr-/- mice, a genetic model of retinal neovascularization. Intravitreal Ceapin-A7 reduced ectopic vascular projections into the outer retina and significantly increased scotopic b-wave amplitude, while a-wave and photopic responses showed no significant difference between groups. Single-nucleus RNA sequencing revealed suppressed ATF6/UPR gene programs and angiogenic pathways in retinal endothelial cells and reduced Müller cell gliosis. These findings demonstrate that pharmacologic ATF6 inhibition mitigates retinal neovascularization in Vldlr-/- mice and identifies ATF6/UPR as a therapeutic target for neovascular retinal diseases.
2026-09-16 | Propofol and fentanyl for laser photocoagulation in non-intubated preterm infants with retinopathy of prematurity.
Retinopathy of prematurity (ROP) is a vasoproliferative retinal disorder of preterm infants, characterized by disrupted retinal vascular development and abnormal neovascularization that result from preterm birth and supplemental oxygen exposure. It is a leading cause of preventable childhood blindness. Laser photocoagulation is a common treatment, but there is no evidence-based consensus on the most appropriate sedation method for this procedure. This study aimed to determine if deep sedation with propofol and fentanyl during laser photocoagulation for ROP is safe and effective while minimizing the side effects of general anesthesia in a vulnerable population. We retrospectively analyzed preterm infants in the neonatal intensive care unit at a tertiary care medical center who underwent deep sedation with propofol and fentanyl administered by pediatric intensivists during retinal ablation for ROP. The primary outcome was change in vital signs from pre- to post-procedure; secondary outcomes were adverse events, including death, apnea, and emergent airway intervention. Nine preterm infants were identified. Gestational age ranged from 22 to 28 weeks, and median weight at the time of the procedure was 4,000 g (range 1,860-6,500). Median sedation time was 117 min (range 85-188). Vital signs remained stable from pre- to post-procedure (p>0.05 for all). Three patients experienced adverse events: one apnea and two emergent airway interventions. No patient required intubation or mechanical ventilation, and photocoagulation was completed in all cases. Deep sedation with propofol and fentanyl may be effective to control pain during retinal ablation for treatment of ROP for patients with low pre-operative risk. Prospective studies should be conducted to further assess efficacy and safety and to improve the standard of care.
2026-09-15 | Clinical Use of Melatonin as a Cross-Sectional Modulator of Oxidative Stress Across the Perinatal Continuum: From Placental Dysfunction to Neonatal Disease.
Oxidative stress is a central mechanism linking placental dysfunction, fetal injury, and neonatal disease, supporting the concept of a perinatal oxidative stress continuum that begins during abnormal placentation and may persist after birth. This narrative review explores the biological rationale and current experimental and clinical evidence for melatonin as a potential multitarget intervention across this continuum. Melatonin combines direct antioxidant activity with mitochondrial protection, anti-inflammatory and anti-apoptotic effects, and modulation of endogenous antioxidant defenses and redox homeostasis. Evidence from placental, fetal, and neonatal studies suggests potential protective effects in pregnancy complications and in neonatal conditions characterized by oxidative injury, including hypoxic-ischemic encephalopathy, bronchopulmonary dysplasia, necrotizing enterocolitis, neonatal sepsis, and retinopathy of prematurity. The review was informed by a non-systematic search of PubMed/MEDLINE, Scopus, Web of Science and Cochrane Library for relevant literature published up to 2026, including preclinical and clinical studies, systematic reviews, and relevant clinical trial registrations. Overall, although preclinical evidence is encouraging and early clinical studies suggest potential safety and biological activity, translation into clinical practice remains limited by heterogeneous study designs, dosing and timing regimens, and the lack of adequately powered randomized trials. Further research is needed to establish optimal dosing, timing, patient selection, pharmacokinetic-pharmacodynamic relationships, and long-term safety and efficacy.
proteins
2026-08-22 | Association of Blood Transfusion and Retinopathy of Prematurity in Preterm Neonate
Background: Retinopathy of prematurity (ROP) is a vaso-proliferative disorder of the immature retina and a leading cause of preventable childhood blindness. Multiple risk factors have been implicated in its development, including oxygen therapy, sepsis and blood transfusion. Objective: This study was conducted to determine the association between blood transfusion and ROP among preterm neonates and to assess the effect of early erythropoietin (EPO) administration on anemia correction and transfusion requirement. Methods: This randomized controlled trial was conducted in the Special Care Baby Unit (SCABU) and Neonatal Intensive Care Unit (NICU) of Dhaka Shishu (Children) Hospital from July 2018 to June 2020. A total of 60 preterm low-birth-weight neonates (<34 weeks gestation, <1800 gm birth weight) were enrolled and randomly allocated into two groups: the EPO group (n=30) and the control group (n=30). The EPO group received recombinant human erythropoietin (400 IU/kg subcutaneously, thrice weekly for two weeks), along with oral iron and folic acid supplementation. Hematologic parameters, blood transfusion requirements and ROP development were evaluated and compared between groups. Results: EPO administration significantly increased hemoglobin, hematocrit and reticulocyte counts and reduced the need for blood transfusion (23.3% vs. 53.3%; p= 0.017). The overall incidence of ROP did not differ significantly between the groups (26.7% vs. 36.7%; p= 0.405). However, a strong association was observed between blood transfusion and ROP development (p= 0.026). Conclusion: Early erythropoietin therapy effectively reduced blood transfusion requirements without increasing ROP risk. Blood transfusion was significantly associated with ROP development, suggesting that restrictive transfusion strategies and early anemia management may help reduce ROP incidence among preterm neonates.
2026-06-26 | Erythropoietin, transfusions, and outcomes of retinopathy of prematurity and brain injury in extremely preterm infants: A post hoc analysis of the Preterm Erythropoietin Neuroprotection Trial (PENUT).
Erythropoietin is perceived as both a neuroprotectant and a biomarker for hypoxic stress. To explore correlations between serum erythropoietin (Epo) concentrations, perinatal risk factors, red blood cell transfusions and recombinant human erythropoietin (rHuEpo) with outcomes including retinopathy of prematurity (ROP) and brain injury on magnetic resonance imaging (MRI) in extremely preterm infants. This is a post hoc analysis of data from the Preterm Erythropoietin Neuroprotection Trial of preterm infants born between 24 0/7 and 27 6/7 weeks gestation and randomized to placebo or rHuEpo treatment (N = 941). Serum Epo concentrations were collected within 24 hours (baseline) and at 7, 9, and 14 days. MRI was obtained at 36 weeks postmenstrual age (N = 220). Baseline Epo concentrations negatively correlated with gestational age, delayed cord clamping, and Apgar scores, and positively correlated with intraventricular hemorrhage and risk of death. Neither endogenous Epo at baseline nor trajectories from birth to 14 days were associated with ROP. In the placebo group, Epo at 1 week of life (r = 0.26, p = 0.033) and 2-week area under the curve (r = 0.28, p = 0.019) positively correlated with white matter injury. In the treatment group, Epo at 14 days negatively correlated with white matter injury (r = -0.35, p = 0.004). Grey matter injury negatively correlated with baseline Epo in the placebo group (r = -0.27, p = 0.01) but positively correlated in the treatment group (r = 0.23, p = 0.047). Transfusions were associated with severe ROP (p < 0.0001) and total brain injury on MRI (p = 0.007). Transfusion volumes in the first week of life were associated with a greater risk of severe ROP in males (p = 0.0006). Endogenous Epo concentrations in preterm infants are influenced by perinatal variables and correlate with poor outcomes. The association of Epo with MRI results differed between placebo and rHuEpo treatment groups. Transfusions were associated with increased ROP and brain injury on MRI.
2026-06-24 | Serum hepcidin is associated with retinopathy of prematurity and modulates oxidative stress and angiogenic responses in retinal microvascular endothelial cells.
Retinopathy of prematurity (ROP) is a vasoproliferative retinal disorder in preterm infants driven by impaired vascular development, hypoxia, oxidative stress, and pathological angiogenesis. Current treatments mainly target VEGF signaling but do not directly address upstream oxidative injury. Hepcidin, a key iron-homeostasis regulator, may modulate redox balance and angiogenic activation. However, whether hepcidin is reduced in ROP and whether supplementation mitigates hypoxia-induced oxidative stress and abnormal angiogenesis in retinal endothelial cells remain unclear. To investigate the effects of hepcidin on human retinal microvascular endothelial cells (hRMECs) under oxidative stress and assess its translational potential in ROP. Clinical data were collected from 35 preterm infants with gestational age <36 weeks, including 24 non-ROP controls and 11 ROP infants. Gestational age, birth weight, ROP stage, and serum hepcidin were analyzed. hRMECs were exposed to 1% O2 to establish a hypoxia model. Cell viability, VEGFA and HIF-1α mRNA expression, secreted VEGFA, intracellular reactive oxygen species (ROS), transcriptomic changes, and tube formation were evaluated. Hepcidin was added under hypoxia to assess its effects on oxidative stress and angiogenic activation. Infants with ROP had lower gestational age and birth weight than controls, and gestational age differed across ROP stage groups. Serum hepcidin-related signals were numerically lower in ROP infants, but no significant stage-dependent decrease was observed. In hRMECs, 1% O2 altered cell viability, upregulated VEGFA and HIF-1α mRNA, increased secreted VEGFA, and promoted ROS accumulation, confirming a hypoxia-induced endothelial stress model. Transcriptomic analysis suggested that hepcidin affected hypoxia-responsive metabolic pathways, including cysteine and methionine, selenocompound, and tryptophan metabolism. Functional validation showed that hepcidin reduced VEGFA at transcript and secreted protein levels, decreased intracellular ROS, and suppressed hypoxia-induced tube formation by reducing junction points, branch points, and total tube length. This study provides preliminary clinical and experimental evidence supporting a potential role of hepcidin-related signaling in ROP. Although the clinical findings are exploratory, the in vitro results indicate that hepcidin can attenuate hypoxia-induced oxidative stress and pathological angiogenic activation in retinal endothelial cells. Hepcidin may represent a biologically relevant pathway and potential candidate for further biomarker and therapeutic research in ROP.
2026-04-29 | Study on the Role of Short Peptide LCKLSL Targeting ANXA2 in Retinal Neovascularization.
Annexin A2 (ANXA2), functioning as a co-receptor for tissue plasminogen activator (tPA) and plasminogen, plays a critical role in retinal neovascularization (RNV). The hexapeptide LCKLSL competitively inhibits ANXA2 activity, offering a potential therapeutic strategy for RNV in retinopathy of prematurity (ROP). This study investigated the efficacy and biosafety of LCKLSL in suppressing RNV using an oxygen-induced retinopathy (OIR) model in C57BL/6J mice. LCKLSL was administered via intravitreal injection, with RNV inhibition evaluated through retinal immunofluorescence and hematoxylin-eosin (HE) staining. Comprehensive safety assessments encompassing short- and long-term evaluations were performed using retinal thickness measurements, electroretinography (ERG), and histological analyses of hepatic/renal tissues. Immunohistochemistry confirmed ANXA2-RNV colocalization and LCKLSL targeting specificity. Molecular mechanisms were analyzed using enzyme-linked immunosorbent assay (ELISA) to quantify cell-surface tPA binding in human retinal microvascular endothelial cells (HRMECs), while qRT-PCR and western blot were employed to detect RNV-related factors. Complementary in vitro experiments using hypoxia-induced human umbilical vein endothelial cells (HUVECs) assessed cellular safety (CCK-8 and TUNEL assays) and therapeutic effects on migration (Wound healing assay), angiogenesis (Matrigel tube formation), and invasion (Transwell assay). LCKLSL significantly attenuated RNV formation without inducing pathological alterations in retinal structure or systemic toxicity. Mechanistically, LCKLSL reduced cell-surface tPA binding and suppressed vascular endothelial growth factor (VEGF) and metalloproteinase (MMP) expression at mRNA and protein levels. In vitro, LCKLSL inhibited HUVEC migration, tube formation, and invasion under hypoxia. LCKLSL acts as a potent ANXA2-targeted inhibitor of pathological angiogenesis and demonstrates a favorable biosafety profile, highlighting its promising therapeutic potential for the treatment of RNV-related disorder.
2026-03-22 | Combined use of erythropoiesis-stimulating agents and transfusion guidelines in NICU infants.
Red blood cell transfusions from adult donors can be lifesaving for neonates with severe anemia or acute massive hemorrhage but can be associated with specific and significant risks. Infectious transmission, acute lung injury, and circulatory overload are well known risks and are part of blood transfusion informed consent. Less well-described, but more common, are the risks that occur when transfusing the smallest and most immature neonates, those less than 1000 g. Repeated adult red cell transfusions may worsen inflammatory conditions, such as pulmonary inflammation, and they can increase the incidence and severity of retinopathy of prematurity and neurodevelopmental delay. In this review, we will provide an overview of neonatal transfusion stewardship including instituting both non-pharmacological transfusion-avoidance techniques and pharmacologic strategies to reduce transfusion rates. Erythropoiesis-stimulating agents like erythropoietin and darbepoetin further reduce and can eliminate the need for a transfusion. Instituting non-pharmacologic and pharmacologic strategies will increase the number of NICU infants who remain transfusion free, even those born weighing less than 1000 g.
antibodies
2026-09-23 | Retinopathy of Prematurity in the Anti-VEGF Era: Screening Systems and Practical Treatment Decision-Making Across Anti-VEGF, Laser, and Surgery.
Retinopathy of prematurity (ROP) is a vasoproliferative disease of the incompletely vascularized retina and remains a major preventable cause of childhood blindness. Its clinical profile varies by region: in high-income countries, severe ROP mainly affects extremely preterm infants, whereas in many low- and middle-income countries it may also occur in larger, more mature infants because neonatal survival has improved faster than screening capacity. The introduction of intravitreal anti-vascular endothelial growth factor (anti-VEGF) therapy has changed ROP management. Anti-VEGF agents can rapidly regress posterior and aggressive ROP and may allow continued peripheral vascularization, but they also introduce challenges including persistent avascular retina, delayed reactivation, retreatment uncertainty, and systemic safety concerns. This review summarizes evidence across the ROP care pathway, including screening, classification, treatment decision-making, surgery, and long-term outcomes. In the anti-VEGF era, treatment success should extend beyond short-term regression to stable retinal vascular maturation, prevention of tractional complications, and sustained developmental follow-up. Anti-VEGF therapy is best supported for Zone I, posterior Zone II, and aggressive ROP, whereas laser remains important for anterior disease, unreliable follow-up settings, and residual avascular retina. Surgery remains necessary for advanced tractional disease. Ranibizumab and aflibercept appear to have more reassuring systemic profiles than bevacizumab, although long-term comparative data remain limited. Faricimab and topical dexamethasone remain investigational. Future priorities include integrated screening networks, standardized retreatment algorithms, and longitudinal registries tracking ocular and developmental outcomes.
2026-08-04 | Retinopathy of prematurity epidemiology and treatment trend in a tertiary medical center in Taiwan: From 2016 to 2023.
To investigate the recent 8-year epidemiology of retinopathy of prematurity (ROP) and treatment modalities in Taiwan. A retrospective study was conducted from 2016 to 2023, using data from Chang Gung Memorial Hospital, Linkou, Taiwan, and enrolling 2078 premature babies who were screened for ROP. The incidence of ROP, type 1 ROP, and initial treatment were analyzed. ROP developed in 671 of the 2078 infants (29.7%), and type 1 ROP was present in 195 infants (9.4%). A declining trend was observed in the number of ROP screenings among premature infants (P = 0.02). The proportion of type 1 ROP decreased significantly from 12.13% in 2016 to 5.0% in 2023 (P < 0.01). Antivascular endothelial growth factor (VEGF) was chosen in 97% and 93.2% of the initial and overall treatments, respectively, with laser mainly used as a secondary treatment. Bevacizumab was the most frequently selected option among the three available anti-VEGF drugs. The incidence of ROP between 2016 and 2023 showed no significant change. The proportion of type 1 ROP decreased during this period. Anti-VEGF was chosen as the initial treatment, and bevacizumab was the most frequently used agent.
2026-07-27 | Observations of simultaneous aggressive anemia correction and intravitreal therapy for aggressive retinopathy of prematurity: A multimodal retinopathy of prematurity assessment study report number 2.
To study the effect of simultaneous aggressive anemia correction and intravitreal anti-vascular endothelial growth factor (anti-VEGF) Bevacizumab in aggressive retinopathy of prematurity (A-ROP) using multimodal imaging biomarkers. Noncontact ultra-widefield fundus imaging with integrated UWF-guided swept source optical coherence tomography (SS-OCT) was performed prospectively before and after intravitreal anti-VEGF (Bevacizumab) monotherapy. For all babies with anemia (hemoglobin <10 g/dL), blood transfusion was requested by the treating ophthalmologist in coordination with the treating neonatologist. Imaging outcomes of babies who were transfused (Group 1, 40 eyes of 20 babies) were compared to those of babies who did not undergo transfusion (Group 2, 40 eyes of 20 babies). All babies in our study were stable and not receiving supplemental oxygen. Group 1 eyes showed faster resolution of multilayered hemorrhages ( P value 0.030) and faster vascular progression to zone 3 ( P value 0.004). Group 2 A-ROP eyes had a higher incidence of reactivation ( P value 0.038), higher incidence of persistent avascular retina (PAR) ( P value 0.044), and need for retreatment with laser ( P value 0.001) when compared to Group 1. Resolution of ischemic OCT biomarkers, resolution of hyperreflectivity of the inner retinal layers, and improvement in choroidal thickness >250 microns were better in Group 1 than in Group 2. Prompt correction of moderate to severe anemia with blood transfusion in anti-VEGF-injected A-ROP eyes resulted in faster resolution of retinal hemorrhages and faster vascular progression to the periphery. These eyes showed improved multimodal imaging biomarkers and a lower chance of reactivation or PAR needing retreatment with laser.
2026-07-03 | Epidemiology and treatment trends of retinopathy of prematurity: a multi-center study involving four Asian centers and one European center (2016-2023).
To investigate regional differences in the epidemiology and treatment of retinopathy of prematurity (ROP) from 2016 to 2023. Retrospective multicenter cohort study METHODS: Premature infants screened for ROP at a single tertiary referral center in each of five countries/regions (Taiwan, Hong Kong, Singapore, India, and Portugal) during the study period. Demographic characteristics, incidences of ROP and type 1 ROP, and treatment modalities were analyzed. Screening criteria followed local protocols. Logistic regression was used to assess trends, and intergroup comparisons were performed using Kruskal-Wallis and chi-square tests. A total of 15,031 premature infants were enrolled. Demographics varied significantly (p <0.001); India had the highest gestational age and birth weight, and the lowest proportion of very low birth weight and extremely low birth weight infants with type 1 ROP (p <0.001). Hong Kong had the lowest ROP incidence, while Singapore showed a significant increase over time (p = 0.003). Type 1 ROP rates were higher in Taiwan and India than in Hong Kong and Singapore, with a significant decline observed only in Taiwan (p = 0.005). Anti-Vascular Endothelial Growth Factor (Anti-VEGF) injections were increasingly preferred as initial treatment, with bevacizumab being the most frequently used (87.3%). From 2016 to 2023, ROP incidence and treatment showed significant regional differences. ROP increased in Singapore, while type 1 ROP decreased significantly in Taiwan. Although anti-VEGF therapy has become more common, laser treatment remains dominant in Hong Kong.
2026-06-30 | Evaluating Treatment Outcomes Of Intravitreal Aflibercept In Retinopathy Of Prematurity
Objective: To evaluate the anatomical treatment outcomes of intravitreal aflibercept in infants with severe Stage 3 retinopathy of prematurity (ROP). Study Design: Prospective cohort study. Place and Duration of Study: LRBT Tertiary Teaching Eye hospita , Karachi, 06 months (August 2025 to January 2026). Patients and Methods: This prospective cohort study was conducted at a tertiary care eye hospital. Sixteen infants (32 eyes) with gestational age <34 weeks and birth weight <2000 g, who had treatment-requiring Stage 3 ROP received intravitreal aflibercept (0.4 mg/0.01 mL). Outcomes were assessed at 1–2 weeks, 4–6 weeks, and 3 months. Continuous variables were summarized as mean ± SD and categorical variables as frequencies and percentages. Descriptive statistics were used. Because of the small sample size and the low number of unfavorable outcomes, any univariate analyses were considered exploratory. Results: At 3 months, complete regression was achieved in 26 eyes (81.3%), partial regression in 4 eyes (12.5%), and no change in 2 eyes (6.2%). No eye showed disease progression or recurrence during follow-up. Two eyes (6.2%) belonging to one infant required rescue laser photocoagulation. Mild subconjunctival hemorrhage occurred in 4 eyes (12.5%); no major ocular or systemic adverse events were observed. Exploratory analysis shows that lower gestational age, lower birth weight, Zone I disease, and aggressive ROP were more in infants with unfavorable outcomes. Conclusion: Intravitreal aflibercept appears to be a safe and effective option for the initial management of severe Stage 3 ROP, with high anatomical regression and few short-term complications. Larger studies with longer follow-up are needed to confirm longterm ocular and systemic safety. Kewords: Aflibercept; Infant; Intravitreal injections; Retinopathy of prematurity; Treatment outcomes.
cell therapies
2026-08-20 | Umbilical Cord-Derived Cell-Based Interventions for Bronchopulmonary Dysplasia and Related Complications in Preterm Infants: A Bayesian Sparse-Data Meta-Analysis.
Bronchopulmonary dysplasia (BPD) is a major complication of prematurity with limited disease-modifying therapies. We evaluated umbilical cord-derived cell-based interventions for BPD and related complications in preterm infants. This Preferred Reporting Items for Systematic Reviews and Meta-Analyses 2020-based systematic review and meta-analysis were registered in PROSPERO. PubMed, Cochrane Library, Web of Science, CNKI, and Wanfang were searched from inception to June 14, 2026. Comparative clinical studies of umbilical cord-derived cell-based interventions in preterm infants at risk of or diagnosed with BPD were included. Outcomes included BPD, BPD severity, death, persistent pulmonary hypertension of the newborn (PPHN), patent ductus arteriosus (PDA), intraventricular hemorrhage (IVH), necrotizing enterocolitis (NEC), retinopathy of prematurity (ROP), late-onset sepsis (LOS), and adverse events (AEs). Bayesian random-effects meta-analysis used a binomial-normal hierarchical model to estimate pooled odds ratios (ORs), 95% credible intervals (CrIs), prediction intervals, and heterogeneity. Twelve studies were included. Umbilical cord-derived cell-based interventions showed a possible protective effect on overall BPD (OR, 0.48; 95% CrI, 0.14-1.20). Stronger associations were observed for severe BPD (OR, 0.17; 95% CrI, 0.01-0.85), moderate or severe BPD (OR, 0.28; 95% CrI, 0.09-0.70), and ROP stage ≥3 (OR, 0.17; 95% CrI, 0.02-0.65). No conclusive benefit or harm was observed for death, PPHN, PDA, IVH, NEC, or LOS. No treatment-related serious AEs were identified. However, prediction intervals were generally wide, and the certainty of evidence was low to very low for most outcomes. Umbilical cord-derived cell-based interventions may reduce the risk of moderate or severe BPD in preterm infants, with an additional potential benefit for ROP stage ≥3. Current evidence remains limited, and larger randomized trials with standardized outcomes and long-term follow-up are needed.
2026-06-05 | Microglial polarization in retinal neovascularization: Friend or foe?
Retinal neovascularization (RNV) is the central pathological process leading to blindness in ischemic retinal diseases, such as retinopathy of prematurity (ROP) and proliferative diabetic retinopathy (PDR). Current anti-vascular endothelial growth factor (VEGF) therapies are limited by incomplete responses and substantial injection burdens, highlighting the importance of elucidating novel regulatory mechanisms underlying RNV. As resident immune cells of the retina, microglia play critical yet complex regulatory roles in RNV through functional polarization. Most studies suggest that pro‑inflammatory M1‑like polarization aggravates vascular leakage and pathological neovascular tuft formation by secreting factors such as VEGF, tumor necrosis factor-alpha (TNF‑α), and interleukin-1 beta (IL‑1β). In contrast, reparative M2‑like polarization has been associated with vascular repair and restoration of tissue homeostasis. However, with the application of emerging technologies such as single‑cell transcriptomics, increasing evidence has revealed substantial phenotypic heterogeneity of microglia within the RNV microenvironment, extending beyond the classical M1/M2 dichotomy. Recent findings further indicate that M2-like phenotypes are not invariably protective. Under specific pathological conditions, including chronic hypoxia and oxidative stress, M2-like microglia may promote fibrosis and aberrant vascular remodeling, suggesting that the functional consequences of microglial polarization are highly dependent on the surrounding microenvironment. Therefore, future therapeutic strategies should not simply aim to alter microglial polarization states, but rather selectively target key signaling pathways and functional modules to transform the destructive inflammatory milieu in RNV into a therapeutic environment conducive to vascular repair. Such approaches may provide a theoretical basis for precision interventions in retinal vascular diseases.
2026-05-23 | Therapeutic potential of mesenchymal stem cell-derived exosome on the retinopathy of prematurity.
Retinopathy of prematurity is a leading cause of childhood blindness caused by insufficient vascularization of the peripheral retina, which eventually leads to retinal ischemia. In the ischemic state, pro-angiogenic factors such as vascular endothelial growth factor (VEGF), Transforming Growth Factor Beta (TGF-b), and Insulin-like Growth Factor 1 (IGF1) are excessively produced leading to pathological neovascularization. One of the current approaches in regenerative medicine is exosomes, derived from mesenchymal stem cell have shown promise as potential anti-angiogenic agents in various ocular diseases, including macular degeneration (AMD), diabetic retinopathy (DR), glaucoma, autoimmune uveitis (AU), optic nerve crush (ONC), and retinopathy of prematurity (ROP). In this narrative review, we aimed to consolidate the current literature on exosomes as a therapeutic strategy for ROP with a brief overview of the applied exosome and available sources and mechanism of action.
2026-05-22 | Effect of mesenchymal stem cell treatment on retinopathy of prematurity in patients with bronchopulmonary dysplasia: experience of a tertiary center.
Retinopathy of prematurity (ROP) and bronchopulmonary dysplasia (BPD) share overlapping mechanisms involving oxidative stress, inflammation, and aberrant angiogenesis. Mesenchymal stem cell (MSC) therapy has shown promise in the treatment of BPD through paracrine modulation and anti-inflammatory effects, but its influence on retinal vascular development remains uncertain. This retrospective case series included five extremely low birth weight (ELBW) infants (<1000 g) who received allogeneic umbilical cord–derived MSC therapy for severe BPD between October 2021 and May 2023. Each infant received intravenous (2 × 10⁶ cells/kg) and intratracheal (1 × 10⁷ cells/kg) MSC administration in a single session. ROP screening and treatment were conducted in accordance with national guidelines. Clinical data and ocular outcomes were analyzed descriptively. The mean gestational age was 26²/₇ weeks (range, 25–28³/₇) and the mean birth weight was 810 g (580–1060 g). MSC therapy was given between postnatal days 36–126 (mean, 74 days). No systemic or ocular complications occurred during hospitalization or follow-up. One infant had no ROP, one developed Type 2 ROP with spontaneous regression, and three developed Type 1 ROP requiring intravitreal bevacizumab. All treated cases achieved complete regression after a single intravitreal bevacizumab injection, without recurrence, repeat injection, or need for laser therapy. MSC therapy appeared clinically safe in ELBW infants with BPD, with no adverse ocular effects. However, ROP developed in most infants despite MSC treatment, suggesting that MSCs do not prevent disease onset. The potential modulatory role of MSCs on retinal angiogenesis warrants further investigation through larger, controlled trials.
2026-03-23 | Transfusion Histories of Neonates Who Developed Severe Retinopathy of Prematurity.
The recent BORN study suggests the incidence of retinopathy of prematurity (ROP) might be significantly reduced by transfusing extremely low gestational age neonates (ELGANs) with red blood cells (RBCs) not from adult donors, but from umbilical cord blood. We are uncertain what proportion of infants with severe ROP had no RBC transfusions and thus would not benefit from changing transfusion practice. We created detailed transfusion histories of all infants in our health system (2021-2024) who developed severe ROP. Severe (stage ≥3) ROP was diagnosed in 34 infants; 32 of these had received 1-18 RBC transfusions. Eleven also received 1-16 platelet transfusions. Two received no transfusions. A small minority of infants with severe ROP were never transfused, thus changing transfusion practice would not likely prevent all cases. However, the great majority had multiple RBC transfusions and thus might benefit from cord blood RBC transfusions.
other
2026-07-12 | AAV-norrin gene therapy rescues retinal defects in mice with Norrie disease and oxygen-induced retinopathy.
Norrin, secreted by retinal Müller cells, activates canonical Wnt signaling via Frizzled-4 and co-receptors. Loss-of-function mutations abolish intraretinal capillary formation in mice. In humans, mutations in NDP, which encodes norrin, cause Norrie disease, characterized by retinal hypovascularization and congenital blindness, and X-linked familial exudative vitreoretinopathy (FEVR), resembling retinopathy of prematurity (ROP). We evaluated adeno-associated viral (AAV) vectors expressing norrin as gene therapy for Norrie disease, FEVR, and ROP. AAV2-7m8 and AAV-ShH10 were tested in juvenile wild-type and norrin-deficient (Ndp KO) mice via intravitreal injection at postnatal day 7, with some mice subjected to oxygen-induced retinopathy (OIR). AAV2-7m8 transduced Müller glia, while AAV-ShH10 targeted retinal ganglion cells. Both vectors fully restored intraretinal capillary growth in Ndp KO mice, normalizing vessel density and plexus organization, preserving the blood-retinal barrier, and rescuing visual function. In OIR, scAAV2-7m8-huNorrin reduced vaso-obliteration and neovascular tuft formation, increasing deep plexus coverage, and suppressed Vegfa164 and Ang-2 upregulation. The findings demonstrate that AAV-mediated norrin delivery efficiently targets retinal glia and neurons, restores vascular structure and function, stabilizes the blood-retinal barrier, and mitigates OIR-induced pathological angiogenesis, supporting its potential as a therapeutic strategy for Norrie-related retinopathies and ROP.
2026-06-03 | Suppression of Retinal Neovascularisation by Tetrahedral Framework Nucleic Acids-Resveratrol Via Dual Anti-Angiogenesis and Anti-Inflammation.
Retinal neovascular diseases, such as retinopathy of prematurity and diabetic retinopathy, threaten vision by disrupting retinal structure and function through pathological neovascularisation and chronic inflammation. Existing anti-VEGF therapies primarily target angiogenesis, offering limited control over inflammation and requiring repeated administration. Here, we developed a resveratrol (RSV)-loaded tetrahedral framework nucleic acid nanostructure (tFNAs-RSV) to achieve concurrent anti-angiogenic and anti-inflammatory effects. tFNAs provided a biocompatible, stable and penetration-efficient carrier that enhanced RSV ocular delivery and bioactivity. In hypoxia-induced retinal neovascularisation models, tFNAs-RSV markedly reduced neovascular lesion area, vascular leakage and retinal inflammatory cell infiltration. Mechanistically, tFNAs-RSV suppressed HIF-1 signalling and inhibited the p38 MAPK pathway and NF-κB p65 pathway. Collectively, these results validate tFNAs-RSV as a promising nanoplatform for treating retinal neovascular diseases, with an emphasis on inhibiting neovascularisation and inflammation.
2026-04-30 | Comprehensive multiomics analyses identify guanylate cyclase activator 1A as a photoreceptor-specific target in a murine model of oxygen-induced retinopathy.
Retinopathy of prematurity (ROP), the leading cause of childhood blindness, is considered a vascular retinopathy; however, clinical studies have reported persistent electrophysiological dysfunctions in some ROP patients with remitted vasculopathy, resulting in severe visual impairments. Therefore, this study sought to unravel the mechanisms underlying persistent electrophysiological dysfunctions and identify a neuronal target in a murine model of oxygen-induced retinopathy (OIR), a widely used animal model for ROP. Retinal vascular morphology and leakage were examined by isolectin B4 staining and fluorescein fundus angiography in the OIR mouse model at P17 and P25. Full-field electroretinogram (ERG) was performed. Moreover, P17 retinas were analyzed with metabolomics and transcriptomics, and the results were validated by quantitative PCR (qPCR) and Western blotting (WB). Whole-cell patch clamp was used to evaluate phototransduction. Lentiviral particles carrying guanylate cyclase activator 1A (Guca1a) cDNA driven by a mouse rod opsin promoter were intravitreally injected into OIR mice, and immunofluorescence, ERG, patch clamp, cGMP measurement, and TUNEL staining were performed for assessments. Vascular lesions in OIR retinas peaked at P17 and recovered at P25. However, a wave and b wave amplitudes in dark- and light-adapted ERGs under all light intensities were deficient at both developmental stages, and electrophysiological dysfunctions persisted in P32 OIR retinas. Multiomics indicates phototransduction defects in isolated photoreceptors. QPCR and WB validated the reduced Guca1a mRNA and its encoding protein levels in P17 and P25 OIR retinas. Patch clamp demonstrated impaired light responses of single rods. Furthermore, lentivirus-mediated photoreceptor-specific expression of GUCA1A recovered electrophysiological functions, improved single rod phototransduction, increased cGMP concentration, and reduced cell death in P17 and P25 OIR retinas. The reduced GUCA1A in photoreceptors is mainly responsible for persistent electrophysiological dysfunctions in OIR mouse retinas, even after the recovery of vessel damage. The photoreceptor GUCA1A may serve as a neuronal target for ROP intervention.
2026-02-06 | Phosphatidylserine exposure by developing astrocytes initiates microglia-mediated developmental cell death.
Developmental cell death is classically attributed to apoptosis, yet in mammalian retina, large numbers of developing astrocytes die non-apoptotically during a defined developmental window. Astrocyte death is important for patterning a cellular template that guides angiogenesis, but the underlying mechanism remains unknown. Here we show that healthy developing astrocytes initiate their own elimination by recruiting microglia via regulated exposure of the membrane lipid phosphatidylserine. Experimentally increasing phosphatidylserine exposure in astrocytes, but not neurons, accelerates their removal by microglia without changing how many astrocytes ultimately survive. This acceleration causes profound vascular defects resembling pathological features of retinopathy of prematurity. Genetic disruption of MFGE8, a phosphatidylserine-binding protein, suppresses microglia-mediated astrocyte killing and prevents vascular pathology despite continued phosphatidylserine exposure. This mechanism extends beyond the retina, because phosphatidylserine also initiates astrocyte death in developing cerebral cortex. Together, these findings identify phosphatidylserine exposure as a developmental signal that times microglia-mediated astrocyte elimination, with essential consequences for neurovascular development.
2026-01-29 | LncRNA KCNQ1OT1 modulates M2 macrophage polarization and angiogenic signaling via the miR-142-3p/TRIM24 axis in retinal neovascularization.
Retinopathy of prematurity (ROP) is a major cause of childhood blindness, driven by hypoxia-induced VEGF overproduction. Anti-VEGF therapy has limitations including recurrence and potential side effects, highlighting the need for upstream interventions. M2 macrophages contribute to ROP pathogenesis, but the regulatory mechanisms controlling their polarization remain unclear. We explored the regulatory interplay among lncRNA KCNQ1OT1, miR-142-3p, and TRIM24 in RAW264.7 and THP-1 macrophages, human retinal microvascular endothelial cells (HRMECs), and an oxygen-induced retinopathy (OIR) mouse model. Interactions were validated via dual-luciferase reporter, RNA immunoprecipitation, and RNA pull-down assays. Effects on macrophage polarization and endothelial function were assessed using flow cytometry, immunofluorescence, and proliferation, migration, and tube formation assays. OIR mice received AAV-mediated KCNQ1OT1 delivery, followed by retinal histology, immunostaining, cytokine measurements, TUNEL assays, RT-qPCR, and Western blot analyses. KCNQ1OT1 acted as a competitive endogenous RNA to sequester miR-142-3p, partially relieving suppression of TRIM24 and attenuating STAT6-mediated M2 polarization. In macrophages, KCNQ1OT1 overexpression reduced M2 markers and VEGFA expression, diminishing pro-angiogenic effects on HRMECs. In OIR mice, AAV-KCNQ1OT1 delivery was associated with reduced retinal neovascularization, decreased M2 macrophage infiltration, and lower VEGFA and inflammatory cytokine levels. The KCNQ1OT1/miR-142-3p/TRIM24 axis influences macrophage polarization and angiogenic signaling in ROP. While preliminary, these findings suggest that targeting this upstream regulatory network may complement existing VEGF-targeted therapies.
small molecules
2026-09-29 | Intratracheal budesonide combined with surfactant for respiratory distress syndrome in preterm infants: A randomized clinical trial.
BackgroundBronchopulmonary dysplasia (BPD) remains a major cause of morbidity among preterm infants with respiratory distress syndrome (RDS). Intratracheal budesonide combined with surfactant may reduce pulmonary inflammation and improve neonatal outcomes.MethodsIn this randomized clinical trial, 160 preterm infants (gestational age 26-32 weeks; birth weight <1500 g) requiring surfactant therapy for RDS were assigned to receive either surfactant alone (n = 80) or surfactant plus budesonide (0.25 mg/kg; n = 80). Primary outcomes were oxygen dependency or respiratory support beyond 21 days of life (the prespecified study respiratory outcome) and in-hospital mortality. Secondary outcomes included sepsis, intraventricular hemorrhage, necrotizing enterocolitis, retinopathy of prematurity, respiratory support duration, and repeat surfactant administration.ResultsBaseline characteristics were comparable between groups. The primary respiratory outcome occurred in 16/80 infants (20.0%) in the budesonide-surfactant group and 26/80 infants (32.5%) in the surfactant-alone group (absolute risk difference -12.5 percentage points; P = 0.105). Mortality was significantly lower in the combination group (1.2% vs 11.2%, P = 0.018), as was culture-proven sepsis (5.0% vs 21.2%, P = 0.004). Infants receiving budesonide required fewer repeat surfactant doses (38.8% vs 61.3%, P = 0.016) and had a shorter duration of nasal continuous positive airway pressure support (10.1 ± 6.0 vs 17.9 ± 11.3 days, P = 0.001). The composite outcome of death or oxygen dependency/respiratory support beyond 21 days of life occurred in 35 infants (43.8%) in the control group and 17 infants (21.3%) in the combination group (P = 0.003).ConclusionsIn preterm infants with RDS, budesonide-surfactant therapy was associated with reduced mortality, sepsis, respiratory support duration, and repeat surfactant use. Although fewer infants in the intervention group met the prespecified respiratory outcome, the difference was not statistically significant. Larger multicenter trials using contemporary BPD definitions and incorporating long-term neurodevelopmental follow-up are needed before efficacy and safety can be established.
2026-09-23 | The CD39-CD73-adenosine axis: a pivotal regulator of retinal homeostasis and diseases.
Extracellular purinergic signaling, mediated by nucleotides such as adenosine triphosphate (ATP) and adenosine, is a critical regulator of retinal homeostasis. Within the retina, this signaling pathway is indispensable for maintaining physiological functions. Dysregulation of extracellular purine balance is a key driver of retinal pathophysiology, contributing to inflammation, pathological angiogenesis, and neurodegeneration in diseases like diabetic retinopathy (DR), age-related macular degeneration (AMD), glaucoma, and retinopathy of prematurity (ROP). The hydrolysis of extracellular ATP to adenosine, primarily orchestrated by the sequential actions of NTPDase1/ENTPD1 (CD39) and ecto-5'-nucleotidase/NT5E (CD73), represents a fundamental mechanism for calibrating purinergic signals and shifting the microenvironment from pro-inflammatory to anti-inflammatory and protective. CD39 and CD73 are pivotal enzymes in regulating retinal purinergic equilibrium. Despite their well-characterized roles in tumor biology and cerebral pathophysiology, the expression, physiological functions, and pathological implications of CD39/CD73 in the retina remain understudied and lack systematic synthesis. This review synthesizes current understanding of the roles of CD39 and CD73 in retinal physiology and pathology, with a focus on their implications in DR, AMD, glaucoma, and ROP. Critically, this review provides the first systematic integration of their layer-specific spatial compartmentalization, context-dependent functional duality, and emerging metabolic roles in photoreceptor homeostasis. We also discuss emerging therapeutic strategies that target this pathway, addressing the growing need for translational research to preserve vision.
2026-09-22 | Ceapin-A7 Suppresses UPR Signaling and Mitigates Retinal Neovascularization in Vldlr-/- Mice.
Pathological neovascularization drives blinding retinal diseases, including diabetic retinopathy, retinopathy of prematurity, and neovascular age-related macular degeneration. Endoplasmic reticulum (ER) stress and unfolded protein response (UPR) signaling are key mechanisms underlying neovascularization. Mice lacking the UPR regulator Activating Transcription Factor 6 (ATF6) show normal retinal vasculature yet are resistant to pathologic neovascularization, suggesting that ATF6 inhibition may mitigate retinal damage and vision loss from aberrant retinal angiogenesis. We tested Ceapin-A7, a selective ATF6 inhibitor, in Vldlr-/- mice, a genetic model of retinal neovascularization. Intravitreal Ceapin-A7 reduced ectopic vascular projections into the outer retina and significantly increased scotopic b-wave amplitude, while a-wave and photopic responses showed no significant difference between groups. Single-nucleus RNA sequencing revealed suppressed ATF6/UPR gene programs and angiogenic pathways in retinal endothelial cells and reduced Müller cell gliosis. These findings demonstrate that pharmacologic ATF6 inhibition mitigates retinal neovascularization in Vldlr-/- mice and identifies ATF6/UPR as a therapeutic target for neovascular retinal diseases.
2026-09-16 | Propofol and fentanyl for laser photocoagulation in non-intubated preterm infants with retinopathy of prematurity.
Retinopathy of prematurity (ROP) is a vasoproliferative retinal disorder of preterm infants, characterized by disrupted retinal vascular development and abnormal neovascularization that result from preterm birth and supplemental oxygen exposure. It is a leading cause of preventable childhood blindness. Laser photocoagulation is a common treatment, but there is no evidence-based consensus on the most appropriate sedation method for this procedure. This study aimed to determine if deep sedation with propofol and fentanyl during laser photocoagulation for ROP is safe and effective while minimizing the side effects of general anesthesia in a vulnerable population. We retrospectively analyzed preterm infants in the neonatal intensive care unit at a tertiary care medical center who underwent deep sedation with propofol and fentanyl administered by pediatric intensivists during retinal ablation for ROP. The primary outcome was change in vital signs from pre- to post-procedure; secondary outcomes were adverse events, including death, apnea, and emergent airway intervention. Nine preterm infants were identified. Gestational age ranged from 22 to 28 weeks, and median weight at the time of the procedure was 4,000 g (range 1,860-6,500). Median sedation time was 117 min (range 85-188). Vital signs remained stable from pre- to post-procedure (p>0.05 for all). Three patients experienced adverse events: one apnea and two emergent airway interventions. No patient required intubation or mechanical ventilation, and photocoagulation was completed in all cases. Deep sedation with propofol and fentanyl may be effective to control pain during retinal ablation for treatment of ROP for patients with low pre-operative risk. Prospective studies should be conducted to further assess efficacy and safety and to improve the standard of care.
2026-09-15 | Clinical Use of Melatonin as a Cross-Sectional Modulator of Oxidative Stress Across the Perinatal Continuum: From Placental Dysfunction to Neonatal Disease.
Oxidative stress is a central mechanism linking placental dysfunction, fetal injury, and neonatal disease, supporting the concept of a perinatal oxidative stress continuum that begins during abnormal placentation and may persist after birth. This narrative review explores the biological rationale and current experimental and clinical evidence for melatonin as a potential multitarget intervention across this continuum. Melatonin combines direct antioxidant activity with mitochondrial protection, anti-inflammatory and anti-apoptotic effects, and modulation of endogenous antioxidant defenses and redox homeostasis. Evidence from placental, fetal, and neonatal studies suggests potential protective effects in pregnancy complications and in neonatal conditions characterized by oxidative injury, including hypoxic-ischemic encephalopathy, bronchopulmonary dysplasia, necrotizing enterocolitis, neonatal sepsis, and retinopathy of prematurity. The review was informed by a non-systematic search of PubMed/MEDLINE, Scopus, Web of Science and Cochrane Library for relevant literature published up to 2026, including preclinical and clinical studies, systematic reviews, and relevant clinical trial registrations. Overall, although preclinical evidence is encouraging and early clinical studies suggest potential safety and biological activity, translation into clinical practice remains limited by heterogeneous study designs, dosing and timing regimens, and the lack of adequately powered randomized trials. Further research is needed to establish optimal dosing, timing, patient selection, pharmacokinetic-pharmacodynamic relationships, and long-term safety and efficacy.
proteins
2026-08-22 | Association of Blood Transfusion and Retinopathy of Prematurity in Preterm Neonate
Background: Retinopathy of prematurity (ROP) is a vaso-proliferative disorder of the immature retina and a leading cause of preventable childhood blindness. Multiple risk factors have been implicated in its development, including oxygen therapy, sepsis and blood transfusion. Objective: This study was conducted to determine the association between blood transfusion and ROP among preterm neonates and to assess the effect of early erythropoietin (EPO) administration on anemia correction and transfusion requirement. Methods: This randomized controlled trial was conducted in the Special Care Baby Unit (SCABU) and Neonatal Intensive Care Unit (NICU) of Dhaka Shishu (Children) Hospital from July 2018 to June 2020. A total of 60 preterm low-birth-weight neonates (<34 weeks gestation, <1800 gm birth weight) were enrolled and randomly allocated into two groups: the EPO group (n=30) and the control group (n=30). The EPO group received recombinant human erythropoietin (400 IU/kg subcutaneously, thrice weekly for two weeks), along with oral iron and folic acid supplementation. Hematologic parameters, blood transfusion requirements and ROP development were evaluated and compared between groups. Results: EPO administration significantly increased hemoglobin, hematocrit and reticulocyte counts and reduced the need for blood transfusion (23.3% vs. 53.3%; p= 0.017). The overall incidence of ROP did not differ significantly between the groups (26.7% vs. 36.7%; p= 0.405). However, a strong association was observed between blood transfusion and ROP development (p= 0.026). Conclusion: Early erythropoietin therapy effectively reduced blood transfusion requirements without increasing ROP risk. Blood transfusion was significantly associated with ROP development, suggesting that restrictive transfusion strategies and early anemia management may help reduce ROP incidence among preterm neonates.
2026-06-26 | Erythropoietin, transfusions, and outcomes of retinopathy of prematurity and brain injury in extremely preterm infants: A post hoc analysis of the Preterm Erythropoietin Neuroprotection Trial (PENUT).
Erythropoietin is perceived as both a neuroprotectant and a biomarker for hypoxic stress. To explore correlations between serum erythropoietin (Epo) concentrations, perinatal risk factors, red blood cell transfusions and recombinant human erythropoietin (rHuEpo) with outcomes including retinopathy of prematurity (ROP) and brain injury on magnetic resonance imaging (MRI) in extremely preterm infants. This is a post hoc analysis of data from the Preterm Erythropoietin Neuroprotection Trial of preterm infants born between 24 0/7 and 27 6/7 weeks gestation and randomized to placebo or rHuEpo treatment (N = 941). Serum Epo concentrations were collected within 24 hours (baseline) and at 7, 9, and 14 days. MRI was obtained at 36 weeks postmenstrual age (N = 220). Baseline Epo concentrations negatively correlated with gestational age, delayed cord clamping, and Apgar scores, and positively correlated with intraventricular hemorrhage and risk of death. Neither endogenous Epo at baseline nor trajectories from birth to 14 days were associated with ROP. In the placebo group, Epo at 1 week of life (r = 0.26, p = 0.033) and 2-week area under the curve (r = 0.28, p = 0.019) positively correlated with white matter injury. In the treatment group, Epo at 14 days negatively correlated with white matter injury (r = -0.35, p = 0.004). Grey matter injury negatively correlated with baseline Epo in the placebo group (r = -0.27, p = 0.01) but positively correlated in the treatment group (r = 0.23, p = 0.047). Transfusions were associated with severe ROP (p < 0.0001) and total brain injury on MRI (p = 0.007). Transfusion volumes in the first week of life were associated with a greater risk of severe ROP in males (p = 0.0006). Endogenous Epo concentrations in preterm infants are influenced by perinatal variables and correlate with poor outcomes. The association of Epo with MRI results differed between placebo and rHuEpo treatment groups. Transfusions were associated with increased ROP and brain injury on MRI.
2026-06-24 | Serum hepcidin is associated with retinopathy of prematurity and modulates oxidative stress and angiogenic responses in retinal microvascular endothelial cells.
Retinopathy of prematurity (ROP) is a vasoproliferative retinal disorder in preterm infants driven by impaired vascular development, hypoxia, oxidative stress, and pathological angiogenesis. Current treatments mainly target VEGF signaling but do not directly address upstream oxidative injury. Hepcidin, a key iron-homeostasis regulator, may modulate redox balance and angiogenic activation. However, whether hepcidin is reduced in ROP and whether supplementation mitigates hypoxia-induced oxidative stress and abnormal angiogenesis in retinal endothelial cells remain unclear. To investigate the effects of hepcidin on human retinal microvascular endothelial cells (hRMECs) under oxidative stress and assess its translational potential in ROP. Clinical data were collected from 35 preterm infants with gestational age <36 weeks, including 24 non-ROP controls and 11 ROP infants. Gestational age, birth weight, ROP stage, and serum hepcidin were analyzed. hRMECs were exposed to 1% O2 to establish a hypoxia model. Cell viability, VEGFA and HIF-1α mRNA expression, secreted VEGFA, intracellular reactive oxygen species (ROS), transcriptomic changes, and tube formation were evaluated. Hepcidin was added under hypoxia to assess its effects on oxidative stress and angiogenic activation. Infants with ROP had lower gestational age and birth weight than controls, and gestational age differed across ROP stage groups. Serum hepcidin-related signals were numerically lower in ROP infants, but no significant stage-dependent decrease was observed. In hRMECs, 1% O2 altered cell viability, upregulated VEGFA and HIF-1α mRNA, increased secreted VEGFA, and promoted ROS accumulation, confirming a hypoxia-induced endothelial stress model. Transcriptomic analysis suggested that hepcidin affected hypoxia-responsive metabolic pathways, including cysteine and methionine, selenocompound, and tryptophan metabolism. Functional validation showed that hepcidin reduced VEGFA at transcript and secreted protein levels, decreased intracellular ROS, and suppressed hypoxia-induced tube formation by reducing junction points, branch points, and total tube length. This study provides preliminary clinical and experimental evidence supporting a potential role of hepcidin-related signaling in ROP. Although the clinical findings are exploratory, the in vitro results indicate that hepcidin can attenuate hypoxia-induced oxidative stress and pathological angiogenic activation in retinal endothelial cells. Hepcidin may represent a biologically relevant pathway and potential candidate for further biomarker and therapeutic research in ROP.
2026-04-29 | Study on the Role of Short Peptide LCKLSL Targeting ANXA2 in Retinal Neovascularization.
Annexin A2 (ANXA2), functioning as a co-receptor for tissue plasminogen activator (tPA) and plasminogen, plays a critical role in retinal neovascularization (RNV). The hexapeptide LCKLSL competitively inhibits ANXA2 activity, offering a potential therapeutic strategy for RNV in retinopathy of prematurity (ROP). This study investigated the efficacy and biosafety of LCKLSL in suppressing RNV using an oxygen-induced retinopathy (OIR) model in C57BL/6J mice. LCKLSL was administered via intravitreal injection, with RNV inhibition evaluated through retinal immunofluorescence and hematoxylin-eosin (HE) staining. Comprehensive safety assessments encompassing short- and long-term evaluations were performed using retinal thickness measurements, electroretinography (ERG), and histological analyses of hepatic/renal tissues. Immunohistochemistry confirmed ANXA2-RNV colocalization and LCKLSL targeting specificity. Molecular mechanisms were analyzed using enzyme-linked immunosorbent assay (ELISA) to quantify cell-surface tPA binding in human retinal microvascular endothelial cells (HRMECs), while qRT-PCR and western blot were employed to detect RNV-related factors. Complementary in vitro experiments using hypoxia-induced human umbilical vein endothelial cells (HUVECs) assessed cellular safety (CCK-8 and TUNEL assays) and therapeutic effects on migration (Wound healing assay), angiogenesis (Matrigel tube formation), and invasion (Transwell assay). LCKLSL significantly attenuated RNV formation without inducing pathological alterations in retinal structure or systemic toxicity. Mechanistically, LCKLSL reduced cell-surface tPA binding and suppressed vascular endothelial growth factor (VEGF) and metalloproteinase (MMP) expression at mRNA and protein levels. In vitro, LCKLSL inhibited HUVEC migration, tube formation, and invasion under hypoxia. LCKLSL acts as a potent ANXA2-targeted inhibitor of pathological angiogenesis and demonstrates a favorable biosafety profile, highlighting its promising therapeutic potential for the treatment of RNV-related disorder.
2026-03-22 | Combined use of erythropoiesis-stimulating agents and transfusion guidelines in NICU infants.
Red blood cell transfusions from adult donors can be lifesaving for neonates with severe anemia or acute massive hemorrhage but can be associated with specific and significant risks. Infectious transmission, acute lung injury, and circulatory overload are well known risks and are part of blood transfusion informed consent. Less well-described, but more common, are the risks that occur when transfusing the smallest and most immature neonates, those less than 1000 g. Repeated adult red cell transfusions may worsen inflammatory conditions, such as pulmonary inflammation, and they can increase the incidence and severity of retinopathy of prematurity and neurodevelopmental delay. In this review, we will provide an overview of neonatal transfusion stewardship including instituting both non-pharmacological transfusion-avoidance techniques and pharmacologic strategies to reduce transfusion rates. Erythropoiesis-stimulating agents like erythropoietin and darbepoetin further reduce and can eliminate the need for a transfusion. Instituting non-pharmacologic and pharmacologic strategies will increase the number of NICU infants who remain transfusion free, even those born weighing less than 1000 g.
antibodies
2026-09-23 | Retinopathy of Prematurity in the Anti-VEGF Era: Screening Systems and Practical Treatment Decision-Making Across Anti-VEGF, Laser, and Surgery.
Retinopathy of prematurity (ROP) is a vasoproliferative disease of the incompletely vascularized retina and remains a major preventable cause of childhood blindness. Its clinical profile varies by region: in high-income countries, severe ROP mainly affects extremely preterm infants, whereas in many low- and middle-income countries it may also occur in larger, more mature infants because neonatal survival has improved faster than screening capacity. The introduction of intravitreal anti-vascular endothelial growth factor (anti-VEGF) therapy has changed ROP management. Anti-VEGF agents can rapidly regress posterior and aggressive ROP and may allow continued peripheral vascularization, but they also introduce challenges including persistent avascular retina, delayed reactivation, retreatment uncertainty, and systemic safety concerns. This review summarizes evidence across the ROP care pathway, including screening, classification, treatment decision-making, surgery, and long-term outcomes. In the anti-VEGF era, treatment success should extend beyond short-term regression to stable retinal vascular maturation, prevention of tractional complications, and sustained developmental follow-up. Anti-VEGF therapy is best supported for Zone I, posterior Zone II, and aggressive ROP, whereas laser remains important for anterior disease, unreliable follow-up settings, and residual avascular retina. Surgery remains necessary for advanced tractional disease. Ranibizumab and aflibercept appear to have more reassuring systemic profiles than bevacizumab, although long-term comparative data remain limited. Faricimab and topical dexamethasone remain investigational. Future priorities include integrated screening networks, standardized retreatment algorithms, and longitudinal registries tracking ocular and developmental outcomes.
2026-08-04 | Retinopathy of prematurity epidemiology and treatment trend in a tertiary medical center in Taiwan: From 2016 to 2023.
To investigate the recent 8-year epidemiology of retinopathy of prematurity (ROP) and treatment modalities in Taiwan. A retrospective study was conducted from 2016 to 2023, using data from Chang Gung Memorial Hospital, Linkou, Taiwan, and enrolling 2078 premature babies who were screened for ROP. The incidence of ROP, type 1 ROP, and initial treatment were analyzed. ROP developed in 671 of the 2078 infants (29.7%), and type 1 ROP was present in 195 infants (9.4%). A declining trend was observed in the number of ROP screenings among premature infants (P = 0.02). The proportion of type 1 ROP decreased significantly from 12.13% in 2016 to 5.0% in 2023 (P < 0.01). Antivascular endothelial growth factor (VEGF) was chosen in 97% and 93.2% of the initial and overall treatments, respectively, with laser mainly used as a secondary treatment. Bevacizumab was the most frequently selected option among the three available anti-VEGF drugs. The incidence of ROP between 2016 and 2023 showed no significant change. The proportion of type 1 ROP decreased during this period. Anti-VEGF was chosen as the initial treatment, and bevacizumab was the most frequently used agent.
2026-07-27 | Observations of simultaneous aggressive anemia correction and intravitreal therapy for aggressive retinopathy of prematurity: A multimodal retinopathy of prematurity assessment study report number 2.
To study the effect of simultaneous aggressive anemia correction and intravitreal anti-vascular endothelial growth factor (anti-VEGF) Bevacizumab in aggressive retinopathy of prematurity (A-ROP) using multimodal imaging biomarkers. Noncontact ultra-widefield fundus imaging with integrated UWF-guided swept source optical coherence tomography (SS-OCT) was performed prospectively before and after intravitreal anti-VEGF (Bevacizumab) monotherapy. For all babies with anemia (hemoglobin <10 g/dL), blood transfusion was requested by the treating ophthalmologist in coordination with the treating neonatologist. Imaging outcomes of babies who were transfused (Group 1, 40 eyes of 20 babies) were compared to those of babies who did not undergo transfusion (Group 2, 40 eyes of 20 babies). All babies in our study were stable and not receiving supplemental oxygen. Group 1 eyes showed faster resolution of multilayered hemorrhages ( P value 0.030) and faster vascular progression to zone 3 ( P value 0.004). Group 2 A-ROP eyes had a higher incidence of reactivation ( P value 0.038), higher incidence of persistent avascular retina (PAR) ( P value 0.044), and need for retreatment with laser ( P value 0.001) when compared to Group 1. Resolution of ischemic OCT biomarkers, resolution of hyperreflectivity of the inner retinal layers, and improvement in choroidal thickness >250 microns were better in Group 1 than in Group 2. Prompt correction of moderate to severe anemia with blood transfusion in anti-VEGF-injected A-ROP eyes resulted in faster resolution of retinal hemorrhages and faster vascular progression to the periphery. These eyes showed improved multimodal imaging biomarkers and a lower chance of reactivation or PAR needing retreatment with laser.
2026-07-03 | Epidemiology and treatment trends of retinopathy of prematurity: a multi-center study involving four Asian centers and one European center (2016-2023).
To investigate regional differences in the epidemiology and treatment of retinopathy of prematurity (ROP) from 2016 to 2023. Retrospective multicenter cohort study METHODS: Premature infants screened for ROP at a single tertiary referral center in each of five countries/regions (Taiwan, Hong Kong, Singapore, India, and Portugal) during the study period. Demographic characteristics, incidences of ROP and type 1 ROP, and treatment modalities were analyzed. Screening criteria followed local protocols. Logistic regression was used to assess trends, and intergroup comparisons were performed using Kruskal-Wallis and chi-square tests. A total of 15,031 premature infants were enrolled. Demographics varied significantly (p <0.001); India had the highest gestational age and birth weight, and the lowest proportion of very low birth weight and extremely low birth weight infants with type 1 ROP (p <0.001). Hong Kong had the lowest ROP incidence, while Singapore showed a significant increase over time (p = 0.003). Type 1 ROP rates were higher in Taiwan and India than in Hong Kong and Singapore, with a significant decline observed only in Taiwan (p = 0.005). Anti-Vascular Endothelial Growth Factor (Anti-VEGF) injections were increasingly preferred as initial treatment, with bevacizumab being the most frequently used (87.3%). From 2016 to 2023, ROP incidence and treatment showed significant regional differences. ROP increased in Singapore, while type 1 ROP decreased significantly in Taiwan. Although anti-VEGF therapy has become more common, laser treatment remains dominant in Hong Kong.
2026-06-30 | Evaluating Treatment Outcomes Of Intravitreal Aflibercept In Retinopathy Of Prematurity
Objective: To evaluate the anatomical treatment outcomes of intravitreal aflibercept in infants with severe Stage 3 retinopathy of prematurity (ROP). Study Design: Prospective cohort study. Place and Duration of Study: LRBT Tertiary Teaching Eye hospita , Karachi, 06 months (August 2025 to January 2026). Patients and Methods: This prospective cohort study was conducted at a tertiary care eye hospital. Sixteen infants (32 eyes) with gestational age <34 weeks and birth weight <2000 g, who had treatment-requiring Stage 3 ROP received intravitreal aflibercept (0.4 mg/0.01 mL). Outcomes were assessed at 1–2 weeks, 4–6 weeks, and 3 months. Continuous variables were summarized as mean ± SD and categorical variables as frequencies and percentages. Descriptive statistics were used. Because of the small sample size and the low number of unfavorable outcomes, any univariate analyses were considered exploratory. Results: At 3 months, complete regression was achieved in 26 eyes (81.3%), partial regression in 4 eyes (12.5%), and no change in 2 eyes (6.2%). No eye showed disease progression or recurrence during follow-up. Two eyes (6.2%) belonging to one infant required rescue laser photocoagulation. Mild subconjunctival hemorrhage occurred in 4 eyes (12.5%); no major ocular or systemic adverse events were observed. Exploratory analysis shows that lower gestational age, lower birth weight, Zone I disease, and aggressive ROP were more in infants with unfavorable outcomes. Conclusion: Intravitreal aflibercept appears to be a safe and effective option for the initial management of severe Stage 3 ROP, with high anatomical regression and few short-term complications. Larger studies with longer follow-up are needed to confirm longterm ocular and systemic safety. Kewords: Aflibercept; Infant; Intravitreal injections; Retinopathy of prematurity; Treatment outcomes.
cell therapies
2026-08-20 | Umbilical Cord-Derived Cell-Based Interventions for Bronchopulmonary Dysplasia and Related Complications in Preterm Infants: A Bayesian Sparse-Data Meta-Analysis.
Bronchopulmonary dysplasia (BPD) is a major complication of prematurity with limited disease-modifying therapies. We evaluated umbilical cord-derived cell-based interventions for BPD and related complications in preterm infants. This Preferred Reporting Items for Systematic Reviews and Meta-Analyses 2020-based systematic review and meta-analysis were registered in PROSPERO. PubMed, Cochrane Library, Web of Science, CNKI, and Wanfang were searched from inception to June 14, 2026. Comparative clinical studies of umbilical cord-derived cell-based interventions in preterm infants at risk of or diagnosed with BPD were included. Outcomes included BPD, BPD severity, death, persistent pulmonary hypertension of the newborn (PPHN), patent ductus arteriosus (PDA), intraventricular hemorrhage (IVH), necrotizing enterocolitis (NEC), retinopathy of prematurity (ROP), late-onset sepsis (LOS), and adverse events (AEs). Bayesian random-effects meta-analysis used a binomial-normal hierarchical model to estimate pooled odds ratios (ORs), 95% credible intervals (CrIs), prediction intervals, and heterogeneity. Twelve studies were included. Umbilical cord-derived cell-based interventions showed a possible protective effect on overall BPD (OR, 0.48; 95% CrI, 0.14-1.20). Stronger associations were observed for severe BPD (OR, 0.17; 95% CrI, 0.01-0.85), moderate or severe BPD (OR, 0.28; 95% CrI, 0.09-0.70), and ROP stage ≥3 (OR, 0.17; 95% CrI, 0.02-0.65). No conclusive benefit or harm was observed for death, PPHN, PDA, IVH, NEC, or LOS. No treatment-related serious AEs were identified. However, prediction intervals were generally wide, and the certainty of evidence was low to very low for most outcomes. Umbilical cord-derived cell-based interventions may reduce the risk of moderate or severe BPD in preterm infants, with an additional potential benefit for ROP stage ≥3. Current evidence remains limited, and larger randomized trials with standardized outcomes and long-term follow-up are needed.
2026-06-05 | Microglial polarization in retinal neovascularization: Friend or foe?
Retinal neovascularization (RNV) is the central pathological process leading to blindness in ischemic retinal diseases, such as retinopathy of prematurity (ROP) and proliferative diabetic retinopathy (PDR). Current anti-vascular endothelial growth factor (VEGF) therapies are limited by incomplete responses and substantial injection burdens, highlighting the importance of elucidating novel regulatory mechanisms underlying RNV. As resident immune cells of the retina, microglia play critical yet complex regulatory roles in RNV through functional polarization. Most studies suggest that pro‑inflammatory M1‑like polarization aggravates vascular leakage and pathological neovascular tuft formation by secreting factors such as VEGF, tumor necrosis factor-alpha (TNF‑α), and interleukin-1 beta (IL‑1β). In contrast, reparative M2‑like polarization has been associated with vascular repair and restoration of tissue homeostasis. However, with the application of emerging technologies such as single‑cell transcriptomics, increasing evidence has revealed substantial phenotypic heterogeneity of microglia within the RNV microenvironment, extending beyond the classical M1/M2 dichotomy. Recent findings further indicate that M2-like phenotypes are not invariably protective. Under specific pathological conditions, including chronic hypoxia and oxidative stress, M2-like microglia may promote fibrosis and aberrant vascular remodeling, suggesting that the functional consequences of microglial polarization are highly dependent on the surrounding microenvironment. Therefore, future therapeutic strategies should not simply aim to alter microglial polarization states, but rather selectively target key signaling pathways and functional modules to transform the destructive inflammatory milieu in RNV into a therapeutic environment conducive to vascular repair. Such approaches may provide a theoretical basis for precision interventions in retinal vascular diseases.
2026-05-23 | Therapeutic potential of mesenchymal stem cell-derived exosome on the retinopathy of prematurity.
Retinopathy of prematurity is a leading cause of childhood blindness caused by insufficient vascularization of the peripheral retina, which eventually leads to retinal ischemia. In the ischemic state, pro-angiogenic factors such as vascular endothelial growth factor (VEGF), Transforming Growth Factor Beta (TGF-b), and Insulin-like Growth Factor 1 (IGF1) are excessively produced leading to pathological neovascularization. One of the current approaches in regenerative medicine is exosomes, derived from mesenchymal stem cell have shown promise as potential anti-angiogenic agents in various ocular diseases, including macular degeneration (AMD), diabetic retinopathy (DR), glaucoma, autoimmune uveitis (AU), optic nerve crush (ONC), and retinopathy of prematurity (ROP). In this narrative review, we aimed to consolidate the current literature on exosomes as a therapeutic strategy for ROP with a brief overview of the applied exosome and available sources and mechanism of action.
2026-05-22 | Effect of mesenchymal stem cell treatment on retinopathy of prematurity in patients with bronchopulmonary dysplasia: experience of a tertiary center.
Retinopathy of prematurity (ROP) and bronchopulmonary dysplasia (BPD) share overlapping mechanisms involving oxidative stress, inflammation, and aberrant angiogenesis. Mesenchymal stem cell (MSC) therapy has shown promise in the treatment of BPD through paracrine modulation and anti-inflammatory effects, but its influence on retinal vascular development remains uncertain. This retrospective case series included five extremely low birth weight (ELBW) infants (<1000 g) who received allogeneic umbilical cord–derived MSC therapy for severe BPD between October 2021 and May 2023. Each infant received intravenous (2 × 10⁶ cells/kg) and intratracheal (1 × 10⁷ cells/kg) MSC administration in a single session. ROP screening and treatment were conducted in accordance with national guidelines. Clinical data and ocular outcomes were analyzed descriptively. The mean gestational age was 26²/₇ weeks (range, 25–28³/₇) and the mean birth weight was 810 g (580–1060 g). MSC therapy was given between postnatal days 36–126 (mean, 74 days). No systemic or ocular complications occurred during hospitalization or follow-up. One infant had no ROP, one developed Type 2 ROP with spontaneous regression, and three developed Type 1 ROP requiring intravitreal bevacizumab. All treated cases achieved complete regression after a single intravitreal bevacizumab injection, without recurrence, repeat injection, or need for laser therapy. MSC therapy appeared clinically safe in ELBW infants with BPD, with no adverse ocular effects. However, ROP developed in most infants despite MSC treatment, suggesting that MSCs do not prevent disease onset. The potential modulatory role of MSCs on retinal angiogenesis warrants further investigation through larger, controlled trials.
2026-03-23 | Transfusion Histories of Neonates Who Developed Severe Retinopathy of Prematurity.
The recent BORN study suggests the incidence of retinopathy of prematurity (ROP) might be significantly reduced by transfusing extremely low gestational age neonates (ELGANs) with red blood cells (RBCs) not from adult donors, but from umbilical cord blood. We are uncertain what proportion of infants with severe ROP had no RBC transfusions and thus would not benefit from changing transfusion practice. We created detailed transfusion histories of all infants in our health system (2021-2024) who developed severe ROP. Severe (stage ≥3) ROP was diagnosed in 34 infants; 32 of these had received 1-18 RBC transfusions. Eleven also received 1-16 platelet transfusions. Two received no transfusions. A small minority of infants with severe ROP were never transfused, thus changing transfusion practice would not likely prevent all cases. However, the great majority had multiple RBC transfusions and thus might benefit from cord blood RBC transfusions.
other
2026-07-12 | AAV-norrin gene therapy rescues retinal defects in mice with Norrie disease and oxygen-induced retinopathy.
Norrin, secreted by retinal Müller cells, activates canonical Wnt signaling via Frizzled-4 and co-receptors. Loss-of-function mutations abolish intraretinal capillary formation in mice. In humans, mutations in NDP, which encodes norrin, cause Norrie disease, characterized by retinal hypovascularization and congenital blindness, and X-linked familial exudative vitreoretinopathy (FEVR), resembling retinopathy of prematurity (ROP). We evaluated adeno-associated viral (AAV) vectors expressing norrin as gene therapy for Norrie disease, FEVR, and ROP. AAV2-7m8 and AAV-ShH10 were tested in juvenile wild-type and norrin-deficient (Ndp KO) mice via intravitreal injection at postnatal day 7, with some mice subjected to oxygen-induced retinopathy (OIR). AAV2-7m8 transduced Müller glia, while AAV-ShH10 targeted retinal ganglion cells. Both vectors fully restored intraretinal capillary growth in Ndp KO mice, normalizing vessel density and plexus organization, preserving the blood-retinal barrier, and rescuing visual function. In OIR, scAAV2-7m8-huNorrin reduced vaso-obliteration and neovascular tuft formation, increasing deep plexus coverage, and suppressed Vegfa164 and Ang-2 upregulation. The findings demonstrate that AAV-mediated norrin delivery efficiently targets retinal glia and neurons, restores vascular structure and function, stabilizes the blood-retinal barrier, and mitigates OIR-induced pathological angiogenesis, supporting its potential as a therapeutic strategy for Norrie-related retinopathies and ROP.
2026-06-03 | Suppression of Retinal Neovascularisation by Tetrahedral Framework Nucleic Acids-Resveratrol Via Dual Anti-Angiogenesis and Anti-Inflammation.
Retinal neovascular diseases, such as retinopathy of prematurity and diabetic retinopathy, threaten vision by disrupting retinal structure and function through pathological neovascularisation and chronic inflammation. Existing anti-VEGF therapies primarily target angiogenesis, offering limited control over inflammation and requiring repeated administration. Here, we developed a resveratrol (RSV)-loaded tetrahedral framework nucleic acid nanostructure (tFNAs-RSV) to achieve concurrent anti-angiogenic and anti-inflammatory effects. tFNAs provided a biocompatible, stable and penetration-efficient carrier that enhanced RSV ocular delivery and bioactivity. In hypoxia-induced retinal neovascularisation models, tFNAs-RSV markedly reduced neovascular lesion area, vascular leakage and retinal inflammatory cell infiltration. Mechanistically, tFNAs-RSV suppressed HIF-1 signalling and inhibited the p38 MAPK pathway and NF-κB p65 pathway. Collectively, these results validate tFNAs-RSV as a promising nanoplatform for treating retinal neovascular diseases, with an emphasis on inhibiting neovascularisation and inflammation.
2026-04-30 | Comprehensive multiomics analyses identify guanylate cyclase activator 1A as a photoreceptor-specific target in a murine model of oxygen-induced retinopathy.
Retinopathy of prematurity (ROP), the leading cause of childhood blindness, is considered a vascular retinopathy; however, clinical studies have reported persistent electrophysiological dysfunctions in some ROP patients with remitted vasculopathy, resulting in severe visual impairments. Therefore, this study sought to unravel the mechanisms underlying persistent electrophysiological dysfunctions and identify a neuronal target in a murine model of oxygen-induced retinopathy (OIR), a widely used animal model for ROP. Retinal vascular morphology and leakage were examined by isolectin B4 staining and fluorescein fundus angiography in the OIR mouse model at P17 and P25. Full-field electroretinogram (ERG) was performed. Moreover, P17 retinas were analyzed with metabolomics and transcriptomics, and the results were validated by quantitative PCR (qPCR) and Western blotting (WB). Whole-cell patch clamp was used to evaluate phototransduction. Lentiviral particles carrying guanylate cyclase activator 1A (Guca1a) cDNA driven by a mouse rod opsin promoter were intravitreally injected into OIR mice, and immunofluorescence, ERG, patch clamp, cGMP measurement, and TUNEL staining were performed for assessments. Vascular lesions in OIR retinas peaked at P17 and recovered at P25. However, a wave and b wave amplitudes in dark- and light-adapted ERGs under all light intensities were deficient at both developmental stages, and electrophysiological dysfunctions persisted in P32 OIR retinas. Multiomics indicates phototransduction defects in isolated photoreceptors. QPCR and WB validated the reduced Guca1a mRNA and its encoding protein levels in P17 and P25 OIR retinas. Patch clamp demonstrated impaired light responses of single rods. Furthermore, lentivirus-mediated photoreceptor-specific expression of GUCA1A recovered electrophysiological functions, improved single rod phototransduction, increased cGMP concentration, and reduced cell death in P17 and P25 OIR retinas. The reduced GUCA1A in photoreceptors is mainly responsible for persistent electrophysiological dysfunctions in OIR mouse retinas, even after the recovery of vessel damage. The photoreceptor GUCA1A may serve as a neuronal target for ROP intervention.
2026-02-06 | Phosphatidylserine exposure by developing astrocytes initiates microglia-mediated developmental cell death.
Developmental cell death is classically attributed to apoptosis, yet in mammalian retina, large numbers of developing astrocytes die non-apoptotically during a defined developmental window. Astrocyte death is important for patterning a cellular template that guides angiogenesis, but the underlying mechanism remains unknown. Here we show that healthy developing astrocytes initiate their own elimination by recruiting microglia via regulated exposure of the membrane lipid phosphatidylserine. Experimentally increasing phosphatidylserine exposure in astrocytes, but not neurons, accelerates their removal by microglia without changing how many astrocytes ultimately survive. This acceleration causes profound vascular defects resembling pathological features of retinopathy of prematurity. Genetic disruption of MFGE8, a phosphatidylserine-binding protein, suppresses microglia-mediated astrocyte killing and prevents vascular pathology despite continued phosphatidylserine exposure. This mechanism extends beyond the retina, because phosphatidylserine also initiates astrocyte death in developing cerebral cortex. Together, these findings identify phosphatidylserine exposure as a developmental signal that times microglia-mediated astrocyte elimination, with essential consequences for neurovascular development.
2026-01-29 | LncRNA KCNQ1OT1 modulates M2 macrophage polarization and angiogenic signaling via the miR-142-3p/TRIM24 axis in retinal neovascularization.
Retinopathy of prematurity (ROP) is a major cause of childhood blindness, driven by hypoxia-induced VEGF overproduction. Anti-VEGF therapy has limitations including recurrence and potential side effects, highlighting the need for upstream interventions. M2 macrophages contribute to ROP pathogenesis, but the regulatory mechanisms controlling their polarization remain unclear. We explored the regulatory interplay among lncRNA KCNQ1OT1, miR-142-3p, and TRIM24 in RAW264.7 and THP-1 macrophages, human retinal microvascular endothelial cells (HRMECs), and an oxygen-induced retinopathy (OIR) mouse model. Interactions were validated via dual-luciferase reporter, RNA immunoprecipitation, and RNA pull-down assays. Effects on macrophage polarization and endothelial function were assessed using flow cytometry, immunofluorescence, and proliferation, migration, and tube formation assays. OIR mice received AAV-mediated KCNQ1OT1 delivery, followed by retinal histology, immunostaining, cytokine measurements, TUNEL assays, RT-qPCR, and Western blot analyses. KCNQ1OT1 acted as a competitive endogenous RNA to sequester miR-142-3p, partially relieving suppression of TRIM24 and attenuating STAT6-mediated M2 polarization. In macrophages, KCNQ1OT1 overexpression reduced M2 markers and VEGFA expression, diminishing pro-angiogenic effects on HRMECs. In OIR mice, AAV-KCNQ1OT1 delivery was associated with reduced retinal neovascularization, decreased M2 macrophage infiltration, and lower VEGFA and inflammatory cytokine levels. The KCNQ1OT1/miR-142-3p/TRIM24 axis influences macrophage polarization and angiogenic signaling in ROP. While preliminary, these findings suggest that targeting this upstream regulatory network may complement existing VEGF-targeted therapies.
Access all drug discovery papers and probability of success in trials forecasts:
Access all drug discovery papers and probability of success in trials forecasts:
Drug Discovery Landscape
21 orphan drug designations for Retinopathy of prematurity, including 2 approved therapies.
21 orphan drug designations for Retinopathy of prematurity, including 2 approved therapies.
Drug | Therapy type | Orphan designation | Clinical trial status | Sponsor |
|---|---|---|---|---|
31-amino acid TREM-1 inhibitory peptide | peptides | FDA | — | SignaBlok, Inc. |
methyldopa | small molecules | FDA | FELIQS Corporation | |
Arginyl-Glutamine Dipeptide | small molecules | FDA | — | Infant Bacterial Therapeutics AB |
Sodium (4Z,7Z,10R,11E,13E,15Z,17S,19Z)10,17-dihydroxy-docosa-4,7,11,13,15,19-hexaenoate | small molecules | EMA | — | Granzer Regulatory Consulting & Services GmbH |
Human Insulin (rDNA) | proteins | FDA | — | Elgan Pharma, Ltd. |
Insulin human | peptides | EMA | — | Sirius Regulatory Consulting EU Limited |
Melatonin | small molecules | EMA | — | Worphmed S.r.l. |
Melatonin | small molecules | FDA | — | WORPHMED Srl |
Melatonin | small molecules | FDA | — | WORPHMED Srl |
Sodium (4Z,7Z,10R,11E,13E,15Z,17S,19Z) 10,17-dihydroxy-docosa-4,7,11,13,15,19-hexaenoate | small molecules | FDA | — | Anida Pharma Inc. |
Propranolol hydrochloride | small molecules | EMA | Recordati Rare Diseases | |
Propranolol | small molecules | FDA | Recordati Rare Diseases, SARL | |
aflibercept [Eylea] | proteins | FDA | Approved | Regeneron Pharmaceuticals, Inc. |
Retinol | small molecules | EMA | — | Orphanix GmbH |
retinol palmitate (vitamin A palmitate) | small molecules | FDA | — | orphanix GmbH |
3-[3-(6-guanidino-1-oxoisoindolin-2yl) propanamido]-3-(pyridine-3yl) propanoic acid dihydrochloride | small molecules | FDA | — | Advanced Imaging Projects, LLC |
mecasermin rinfabate | proteins | FDA | OHB Neonatology Ltd | |
hydroxyprogesterone caproate [Makena] | — | FDA | Approved | AMAG Pharma USA, Inc. |
Mecasermin rinfabate | proteins | EMA | Orphix Consulting GmbH | |
myo-inositol | small molecules | FDA | Abbott Nutrition | |
Antisense Oligonucleotide (TATCCGGAGGGCTCGCCATGCTGCT) | oligonucleotides | EMA | — | Gene Signal SAS |
“Terminated” – programs with discontinued clinical trials, or with no updates reported for 5 years after completion or 12 years after the last trial started.
Let's accelerate rare disease drug discovery
Let's accelerate drug discovery
Get access to Explority AI’s forecasts to outperform average preclinical success rates. Whether you’re expanding your R&D pipeline, evaluating a partnership, or simply have a question — we’d love to hear from you.