AI Drug Discovery for Pharma and Biotech

Drug discovery

21

drugs

With orphan designations

Overview

Retinopathy of prematurity (ROP) is a retinal vascular disorder affecting premature infants, particularly those born before 31 weeks gestation or weighing <1500g. Abnormal blood vessel proliferation can lead to retinal detachment and blindness if untreated. While 90% of cases resolve spontaneously, severe ROP (stages 3-5) requires intervention. Screening protocols recommend initial ophthalmologic exams 4-6 weeks postnatally for at-risk infants, with close monitoring until retinal vascularization completes. [1][2][6]

Population

  • Primarily affects infants born <31 weeks gestation or <1500g birth weight [1][6]

  • Higher incidence among Black/Hispanic infants and those from lower-income households [2][12]

  • Male sex, oxygen therapy complications, and multiple births increase risk [6][12]

Burden

  • US incidence increased 86% (2003-2019), disproportionately impacting Southern/Midwestern regions [2][19]

  • Global childhood blindness: 6-18% of cases attributed to ROP [4][7]

  • Economic impact: ROP increases neonatal ICU costs by 16% compared to non-ROP prematurity [2][17]

Therapies

  • Laser photocoagulation: Gold standard for peripheral retinal ablation in stage 3 [3][17]

  • Anti-VEGF agents (e.g., bevacizumab): First-line for zone I disease to inhibit pathologic angiogenesis [5][13]

  • Surgical interventions: Vitrectomy/scleral buckling for stages 4-5 retinal detachment [1][17]

Categories: rare ophthalmic disorders

Research Papers

3,126 drug discovery papers related to Retinopathy of prematurity, with 5 first-in-class and 28 next-in-class early-stage therapies forecasted to outperform the average preclinical success rate. Recent publications:

3,126 drug discovery papers related to Retinopathy of prematurity, with 5 first-in-class and 28 next-in-class early-stage therapies forecasted to outperform the average preclinical success rate. Recent publications:

2026-07-12 | AAV-norrin gene therapy rescues retinal defects in mice with Norrie disease and oxygen-induced retinopathy.

Norrin, secreted by retinal Müller cells, activates canonical Wnt signaling via Frizzled-4 and co-receptors. Loss-of-function mutations abolish intraretinal capillary formation in mice. In humans, mutations in NDP, which encodes norrin, cause Norrie disease, characterized by retinal hypovascularization and congenital blindness, and X-linked familial exudative vitreoretinopathy (FEVR), resembling retinopathy of prematurity (ROP). We evaluated adeno-associated viral (AAV) vectors expressing norrin as gene therapy for Norrie disease, FEVR, and ROP. AAV2-7m8 and AAV-ShH10 were tested in juvenile wild-type and norrin-deficient (Ndp KO) mice via intravitreal injection at postnatal day 7, with some mice subjected to oxygen-induced retinopathy (OIR). AAV2-7m8 transduced Müller glia, while AAV-ShH10 targeted retinal ganglion cells. Both vectors fully restored intraretinal capillary growth in Ndp KO mice, normalizing vessel density and plexus organization, preserving the blood-retinal barrier, and rescuing visual function. In OIR, scAAV2-7m8-huNorrin reduced vaso-obliteration and neovascular tuft formation, increasing deep plexus coverage, and suppressed Vegfa164 and Ang-2 upregulation. The findings demonstrate that AAV-mediated norrin delivery efficiently targets retinal glia and neurons, restores vascular structure and function, stabilizes the blood-retinal barrier, and mitigates OIR-induced pathological angiogenesis, supporting its potential as a therapeutic strategy for Norrie-related retinopathies and ROP.

Open article ↗



2026-07-11 | Moderating effects of maternal-infant interaction on the relationship between adverse neonatal exposures and the development of autistic behaviors at follow-up: A preterm birth cohort study.

Preterm-birth infants have elevated risks of autistic behaviors compared to term-birth infants. While neonatal adverse exposures and the morbidity burden in the neonatal intensive care units are often used to forecast neurodevelopmental outcomes including autism, the extent to which post-discharge maternal psychosocial health and mother-infant interactions mitigate early autistic behaviors remains unclear. To examine whether the maternal psychosocial status and maternal-infant interaction at 6 months moderate the association between neonatal morbidity exposures and autistic behaviors in a longitudinal preterm cohort. We conducted a cohort study of infants born at <33 weeks' gestation in southern Taiwan. Neonatal morbidity counts (0-5) of severe brain injury, sepsis, necrotizing enterocolitis, severe retinopathy of prematurity, and bronchopulmonary dysplasia were recorded. Family social risks were assessed at discharge. At 6 months of infant's corrected age, mothers completed measures of depression, state anxiety, partnership quality, and the BRIGANCE® Parent-Child Interaction. At 24 months, autistic behaviors were screened using the Modified Checklist for Autism, Revised (>2 as positive), and neurodevelopment was measured by the Bayley Scales of Infant and Toddler Development, Third Edition. Analyses included group comparisons, a multivariable logistic regression, and interaction (moderation) between morbidity counts and parent-child interaction scores. Of 472 infants who survived to discharge, eight infants died after discharge, and 336 (72.4%) completed the 24-month follow-up. Twenty-six (7.7%) infants screened positive for autistic behaviors. Groups did not differ in gestational age, sex, anthropometrics, or neonatal morbidities. Screen-positive toddlers had lower cognition, language, and motor scores (all p ≤ 0.001). In the adjusted models, lower maternal education increased the odds of autistic behaviors (odds ratio [OR] 4.06, 95% confidence interval [CI] 1.37-12.06), whereas a higher parent-child interaction score was associated with a lower likelihood of autistic behaviors (OR 0.80, 95% CI 0.72-0.89). Higher parent-child interaction attenuated the association between greater neonatal morbidity counts and autistic behaviors (interaction OR 1.31, 95% CI 1.02-1.68). High-quality interactions were associated with lower autistic-behavior prevalence across morbidity strata, especially in those with no neonatal morbidity. In preterm infants, post-discharge relational and social factors-especially higher-quality maternal-infant interactions and maternal education-were more strongly linked to autistic outcomes than the neonatal morbidity burden alone. Positive maternal-infant interactions appear to buffer neonatal morbidity vulnerability, supporting the need for routine 6-month screening of the maternal psychosocial status and dyadic interactions, and motivating pragmatic, relationship-focused early interventions to reduce autistic behaviors in high-risk preterm children.

Open article ↗



2026-07-11 | Efficacy and safety of procedural sedation-analgesia during laser photocoagulation for retinopathy of prematurity: a systematic review.

Laser photocoagulation for retinopathy of prematurity (ROP) in preterm infants causes significant procedural pain. Although general anaesthesia (GA) is the standard of care, many settings frequently rely on inadequate sedation-analgesia or topical anaesthesia alone, exposing neonates to considerable pain and clinical instability. This systematic review aimed to evaluate the efficacy and safety of procedural sedation-analgesia during laser photocoagulation for ROP. We searched MEDLINE, Embase, and Cochrane CENTRAL for trials investigating sedation-analgesic agents during laser photocoagulation. Primary outcome was analgesic efficacy (pain score reduction, rescue analgesics required). Additional outcomes included adverse effects (e.g., apnea, oxygen requirement). Two reviewers extracted relevant information and assessed risk-of-bias using ROB2 and evidence certainty using GRADE methodology. Of 540 articles screened, four relevant RCTs were identified (n = 265). These RCTs compared varying combinations of agents (oral dextrose vs. no dextrose, fentanyl vs. oral sucrose, fentanyl vs. ketamine, ketamine-propofol vs. GA). Three RCTs evaluating pain-related outcomes (PIPP-R score and intra-procedural crying duration) suggested that the investigated non-general anaesthetic regimens may provide inadequate procedural analgesia (low to very low-certainty evidence). The evidence is very uncertain about the effect of ketamine-propofol on post-procedure ventilation requirement compared with general anaesthesia. Apnea was the commonest adverse effect (three studies), especially with high-dose fentanyl (30%). Three studies had a low risk-of-bias, while one had some concerns (randomisation, outcome measurement). Overall, the included studies were small RCTs evaluating varying combinations of interventions, precluding concrete conclusions about the superiority of any analgesic regimen during laser photocoagulation. Further high-quality studies are needed to identify safe and effective analgesia for settings where GA is unavailable. Prospectively registered on PROSPERO (CRD420251070146). • Laser photocoagulation procedure for retinopathy of prematurity is immensely painful. • Despite general anaesthesia being the standard, most neonates undergo the procedure under inadequate analgesia, particularly in high-burden settings. Optimal analgesic regimen for the laser procedure, in settings where general anaesthesia is unavailable, is unknown. • This systematic review of trials investigating analgesic agents for laser procedure for ROP found four RCTs with significant heterogeneity in intervention agents. • Low- to very low-certainty evidence suggests that none of the evaluated sedo-analgesic regimens consistently achieved optimal analgesia, and most infants continued to experience moderate-to-severe procedural pain.

Open article ↗



2026-07-12 | AAV-norrin gene therapy rescues retinal defects in mice with Norrie disease and oxygen-induced retinopathy.

Norrin, secreted by retinal Müller cells, activates canonical Wnt signaling via Frizzled-4 and co-receptors. Loss-of-function mutations abolish intraretinal capillary formation in mice. In humans, mutations in NDP, which encodes norrin, cause Norrie disease, characterized by retinal hypovascularization and congenital blindness, and X-linked familial exudative vitreoretinopathy (FEVR), resembling retinopathy of prematurity (ROP). We evaluated adeno-associated viral (AAV) vectors expressing norrin as gene therapy for Norrie disease, FEVR, and ROP. AAV2-7m8 and AAV-ShH10 were tested in juvenile wild-type and norrin-deficient (Ndp KO) mice via intravitreal injection at postnatal day 7, with some mice subjected to oxygen-induced retinopathy (OIR). AAV2-7m8 transduced Müller glia, while AAV-ShH10 targeted retinal ganglion cells. Both vectors fully restored intraretinal capillary growth in Ndp KO mice, normalizing vessel density and plexus organization, preserving the blood-retinal barrier, and rescuing visual function. In OIR, scAAV2-7m8-huNorrin reduced vaso-obliteration and neovascular tuft formation, increasing deep plexus coverage, and suppressed Vegfa164 and Ang-2 upregulation. The findings demonstrate that AAV-mediated norrin delivery efficiently targets retinal glia and neurons, restores vascular structure and function, stabilizes the blood-retinal barrier, and mitigates OIR-induced pathological angiogenesis, supporting its potential as a therapeutic strategy for Norrie-related retinopathies and ROP.

Open article ↗



2026-07-11 | Moderating effects of maternal-infant interaction on the relationship between adverse neonatal exposures and the development of autistic behaviors at follow-up: A preterm birth cohort study.

Preterm-birth infants have elevated risks of autistic behaviors compared to term-birth infants. While neonatal adverse exposures and the morbidity burden in the neonatal intensive care units are often used to forecast neurodevelopmental outcomes including autism, the extent to which post-discharge maternal psychosocial health and mother-infant interactions mitigate early autistic behaviors remains unclear. To examine whether the maternal psychosocial status and maternal-infant interaction at 6 months moderate the association between neonatal morbidity exposures and autistic behaviors in a longitudinal preterm cohort. We conducted a cohort study of infants born at <33 weeks' gestation in southern Taiwan. Neonatal morbidity counts (0-5) of severe brain injury, sepsis, necrotizing enterocolitis, severe retinopathy of prematurity, and bronchopulmonary dysplasia were recorded. Family social risks were assessed at discharge. At 6 months of infant's corrected age, mothers completed measures of depression, state anxiety, partnership quality, and the BRIGANCE® Parent-Child Interaction. At 24 months, autistic behaviors were screened using the Modified Checklist for Autism, Revised (>2 as positive), and neurodevelopment was measured by the Bayley Scales of Infant and Toddler Development, Third Edition. Analyses included group comparisons, a multivariable logistic regression, and interaction (moderation) between morbidity counts and parent-child interaction scores. Of 472 infants who survived to discharge, eight infants died after discharge, and 336 (72.4%) completed the 24-month follow-up. Twenty-six (7.7%) infants screened positive for autistic behaviors. Groups did not differ in gestational age, sex, anthropometrics, or neonatal morbidities. Screen-positive toddlers had lower cognition, language, and motor scores (all p ≤ 0.001). In the adjusted models, lower maternal education increased the odds of autistic behaviors (odds ratio [OR] 4.06, 95% confidence interval [CI] 1.37-12.06), whereas a higher parent-child interaction score was associated with a lower likelihood of autistic behaviors (OR 0.80, 95% CI 0.72-0.89). Higher parent-child interaction attenuated the association between greater neonatal morbidity counts and autistic behaviors (interaction OR 1.31, 95% CI 1.02-1.68). High-quality interactions were associated with lower autistic-behavior prevalence across morbidity strata, especially in those with no neonatal morbidity. In preterm infants, post-discharge relational and social factors-especially higher-quality maternal-infant interactions and maternal education-were more strongly linked to autistic outcomes than the neonatal morbidity burden alone. Positive maternal-infant interactions appear to buffer neonatal morbidity vulnerability, supporting the need for routine 6-month screening of the maternal psychosocial status and dyadic interactions, and motivating pragmatic, relationship-focused early interventions to reduce autistic behaviors in high-risk preterm children.

Open article ↗



2026-07-11 | Efficacy and safety of procedural sedation-analgesia during laser photocoagulation for retinopathy of prematurity: a systematic review.

Laser photocoagulation for retinopathy of prematurity (ROP) in preterm infants causes significant procedural pain. Although general anaesthesia (GA) is the standard of care, many settings frequently rely on inadequate sedation-analgesia or topical anaesthesia alone, exposing neonates to considerable pain and clinical instability. This systematic review aimed to evaluate the efficacy and safety of procedural sedation-analgesia during laser photocoagulation for ROP. We searched MEDLINE, Embase, and Cochrane CENTRAL for trials investigating sedation-analgesic agents during laser photocoagulation. Primary outcome was analgesic efficacy (pain score reduction, rescue analgesics required). Additional outcomes included adverse effects (e.g., apnea, oxygen requirement). Two reviewers extracted relevant information and assessed risk-of-bias using ROB2 and evidence certainty using GRADE methodology. Of 540 articles screened, four relevant RCTs were identified (n = 265). These RCTs compared varying combinations of agents (oral dextrose vs. no dextrose, fentanyl vs. oral sucrose, fentanyl vs. ketamine, ketamine-propofol vs. GA). Three RCTs evaluating pain-related outcomes (PIPP-R score and intra-procedural crying duration) suggested that the investigated non-general anaesthetic regimens may provide inadequate procedural analgesia (low to very low-certainty evidence). The evidence is very uncertain about the effect of ketamine-propofol on post-procedure ventilation requirement compared with general anaesthesia. Apnea was the commonest adverse effect (three studies), especially with high-dose fentanyl (30%). Three studies had a low risk-of-bias, while one had some concerns (randomisation, outcome measurement). Overall, the included studies were small RCTs evaluating varying combinations of interventions, precluding concrete conclusions about the superiority of any analgesic regimen during laser photocoagulation. Further high-quality studies are needed to identify safe and effective analgesia for settings where GA is unavailable. Prospectively registered on PROSPERO (CRD420251070146). • Laser photocoagulation procedure for retinopathy of prematurity is immensely painful. • Despite general anaesthesia being the standard, most neonates undergo the procedure under inadequate analgesia, particularly in high-burden settings. Optimal analgesic regimen for the laser procedure, in settings where general anaesthesia is unavailable, is unknown. • This systematic review of trials investigating analgesic agents for laser procedure for ROP found four RCTs with significant heterogeneity in intervention agents. • Low- to very low-certainty evidence suggests that none of the evaluated sedo-analgesic regimens consistently achieved optimal analgesia, and most infants continued to experience moderate-to-severe procedural pain.

Open article ↗



Access all drug discovery articles and probability of success in trials forecasts:

Access all drug discovery articles and probability of success in trials forecasts:

Drug Discovery Landscape

21 orphan drug designations for Retinopathy of prematurity, including 2 approved therapies.

21 orphan drug designations for Retinopathy of prematurity, including 2 approved therapies.

Drug

Therapy type

Regulator

Orphan designation

Approval

Sponsor

31-amino acid TREM-1 inhibitory peptide

peptides

FDA

2026-03-22

SignaBlok, Inc.

methyldopa

small molecules

FDA

2024-02-27

FELIQS Corporation

Arginyl-Glutamine Dipeptide

small molecules

FDA

2022-09-20

Infant Bacterial Therapeutics AB

Sodium (4Z,7Z,10R,11E,13E,15Z,17S,19Z)10,17-dihydroxy-docosa-4,7,11,13,15,19-hexaenoate

small molecules

EMA

2022-06-21

Granzer Regulatory Consulting & Services GmbH

Human Insulin (rDNA)

proteins

FDA

2022-02-28

Elgan Pharma, Ltd.

Insulin human

peptides

EMA

2022-01-14

Sirius Regulatory Consulting EU Limited

Melatonin

small molecules

EMA

2021-06-21

Worphmed S.r.l.

Melatonin

small molecules

FDA

2020-04-20

WORPHMED Srl

Melatonin

small molecules

FDA

2020-04-20

WORPHMED Srl

Sodium (4Z,7Z,10R,11E,13E,15Z,17S,19Z) 10,17-dihydroxy-docosa-4,7,11,13,15,19-hexaenoate

small molecules

FDA

2020-03-30

Anida Pharma Inc.

Propranolol hydrochloride

small molecules

EMA

2019-10-17

Recordati Rare Diseases

Propranolol

small molecules

FDA

2019-08-23

Recordati Rare Diseases, SARL

aflibercept [Eylea]

proteins

FDA

2019-07-23

2023-02-08

Regeneron Pharmaceuticals, Inc.

Retinol

small molecules

EMA

2017-07-17

Orphanix GmbH

retinol palmitate (vitamin A palmitate)

small molecules

FDA

2017-06-28

orphanix GmbH

3-[3-(6-guanidino-1-oxoisoindolin-2yl) propanamido]-3-(pyridine-3yl) propanoic acid dihydrochloride

small molecules

FDA

2017-01-17

Advanced Imaging Projects, LLC

mecasermin rinfabate

proteins

FDA

2012-09-20

OHB Neonatology Ltd

hydroxyprogesterone caproate [Makena]

FDA

2007-01-25

2011-02-03

AMAG Pharma USA, Inc.

Mecasermin rinfabate

proteins

EMA

2006-08-28

Orphix Consulting GmbH

myo-inositol

small molecules

FDA

2005-04-07

Abbott Nutrition

Antisense Oligonucleotide (TATCCGGAGGGCTCGCCATGCTGCT)

oligonucleotides

EMA

2003-10-02

Gene Signal SAS

Explority AI logo

228 Park Ave S,
New York, USA.

At Explority, we build first-of-its-kind AI to bring clarity to the earliest and riskiest stages of pharmaceutical research by forecasting which therapies are most likely to succeed. Explority AI web and mobile applications are properties of the Explority AI Inc., a company registered in the United States (File No. 10320493).
For all questions: support@explority.ai

Copyright © 2026 Explority AI Inc.

Explority AI logo

228 Park Ave S,
New York, USA.

At Explority, we build first-of-its-kind AI to bring clarity to the earliest and riskiest stages of pharmaceutical research by forecasting which therapies are most likely to succeed. Explority AI web and mobile applications are properties of the Explority AI Inc., a company registered in the United States (File No. 10320493).
For all questions: support@explority.ai

Copyright © 2026 Explority AI Inc.

Explority AI logo

228 Park Ave S,
New York, USA.

At Explority, we build first-of-its-kind AI to bring clarity to the earliest and riskiest stages of pharmaceutical research by forecasting which therapies are most likely to succeed. Explority AI web and mobile applications are properties of the Explority AI Inc., a company registered in the United States (File No. 10320493).
For all questions: support@explority.ai

Copyright © 2026 Explority AI Inc.