AI Drug Discovery for Pharma and Biotech

Drug discovery

155

drugs

With orphan designations

Overview

Duchenne muscular dystrophy (DMD) is an X-linked recessive disorder caused by mutations in the dystrophin gene, leading to progressive skeletal and cardiac muscle degeneration. Symptoms typically emerge by age 2–6 years, with loss of ambulation by early adolescence and life-threatening cardiorespiratory complications by adulthood [1][6][17]. Current management involves multidisciplinary care, corticosteroids, and advanced therapies targeting dystrophin restoration [3][16].

Population

  • Affects ~1 in 3,500–6,300 male live births [2][7][17], with ~20,000 new global cases annually [7][12]. Female carriers may exhibit mild symptoms [6][17].

Burden

  • Annual societal costs range from $80,120–$120,910 per patient [4][9], with substantial caregiver burden [14][19].

  • Median survival remains ~23.7 years despite advancements [12], with wheelchair dependence by ~13 years [5][17].

  • Quality of life declines significantly with disease progression, impacting mental health and family dynamics [10][14].

Therapies

  1. Corticosteroids: First-line treatment to delay muscle decline (e.g., prednisone, deflazacort) [1][3][16].

  2. Dystrophin-targeted therapies: Exon-skipping agents (eteplirsen, golodirsen), stop-codon readthrough (ataluren), and AAV-mediated gene therapy (Elevidys) [3][13][18].

  3. Supportive care: Physical/occupational therapy, cardiac/respiratory surveillance, and surgical interventions [1][11][16].

Categories: rare cardiac diseases, rare genetic diseases, rare neurological diseases, rare ophthalmic disorders, rare transplant-related disorders

Research Papers

5,313 drug discovery papers about Duchenne muscular dystrophy, with 74 next-in-class emerging drug candidates forecasted to outperform the average preclinical success rate. Recent publications:

5,313 drug discovery papers about Duchenne muscular dystrophy, with 74 next-in-class emerging drug candidates forecasted to outperform the average preclinical success rate. Recent publications:

categories:

Small molecules

gene therapies
2026-09-24 | RNA trans-splicing treatment for Duchenne muscular dystrophy.

Duchenne muscular dystrophy (DMD) is a fatal disorder caused by dystrophin mutations, leading to progressive muscle degeneration and cardiac failure. Although AAV-based DMD therapies with innovative designs to overcome the cargo limits of the virus are effective in animal models, these current systems may face clinical translation challenges related to efficiency, off-target effects, and immunogenicity. We developed a multi-vector RNA End Joining (REJ) system to split large genes into multiple co-delivered AAVs that engage the cell's intrinsic spliceosome to precisely reassemble RNA segments that encode very large scar-free proteins. We show the system is efficient and has negligible off-target interactions. In vivo , REJ vectors expressing the adenine base editor Abe8e, mini-dystrophin Dp253, or native full-length dystrophin Dp427 each prevented muscle degeneration. Machine-learning histopathology of more than 120,000 myofibers revealed robust reductions in nuclear infiltration, improved centronucleation, and normalized hypertrophy, supported by functional, transcriptomic, and behavioral analyses. These findings establish REJ as a clinically viable AAV-based strategy for DMD that enables expression of large therapeutic proteins while avoiding potentially antigenic bacterial protein- or DNA-recombinases.

Open article ↗



2026-09-16 | Development of an AAV-Encoded Adenine Base Editor for Duchenne Muscular Dystrophy.

Duchenne muscular dystrophy (DMD) is a devastating X-linked disorder caused by out-of-frame mutations in the DMD gene, most commonly large deletions or duplications, as well as nonsense and splice site mutations, that result in the absence of functional dystrophin protein. These mutations lead to progressive skeletal and cardiac muscle failure. In particular, exon 52 of the DMD gene represents a mutational hotspot in DMD patients. Deletion of exon 52 (DMDΔ52) disrupts the reading frame, leading to premature termination of translation. Here, we used a dual recombinant adeno-associated virus (rAAV) system employing an intein-mediated split strategy to deliver ABE8e using the PAM-less SpRY Cas9 nickase for adenine base editing of splice acceptor sites (SAS) in the dystrophin gene. Targeting the SAS of exon 51 or exon 53 in a DMDΔ52 background aims to induce exon skipping, thereby restoring the open reading frame, in effect converting the severe DMD phenotype into a milder Becker muscular dystrophy (BMD)-like phenotype. We systematically screened sgRNAs in porcine kidney fibroblasts and human embryonic kidney cells (HEK293T), identifying a guide RNA targeting the SAS of exon 53 as the most effective candidate with high on-target editing efficacies and minimal bystander editing. In human DMDΔ52 iPSC-derived cardiomyocytes cultivated as 2D monolayers, high editing efficiencies were achieved with the optimized 1:2 ratio of N-Terminus to C-Terminus. Functional assessment in 3D engineered heart patches revealed a trend toward normalization of the arrhythmic DMD phenotype with an increase in the effective refractory period (ERP) and a reduction in arrhythmic load compared with untreated DMD patches, despite lower editing efficacy in the 3D setting. These findings suggest that even modest levels of base editing-mediated exon skipping may ameliorate the DMD cardiac phenotype toward a BMD-like state, supporting the translational potential of this dual rAAV base editing approach for DMD cardiomyopathy.

Open article ↗



2026-09-11 | Multiplexed genome editing by CRISPR-Un1Cas12f1 restores dystrophin expression in a mouse model of Duchenne muscular dystrophy.

The compact type V clustered regularly interspaced short palindromic repeats (CRISPR) nuclease Un1Cas12f1 is compatible with adeno-associated virus (AAV)-mediated genome editing, although the protospacer adjacent motif (PAM) requirements and capacity for multiplexed genome editing remain undefined. Here, we show that Un1Cas12f1 exhibits a broad tolerance for non-canonical PAMs, including Y-rich motifs with a preference for TTCR and TCTA PAMs, thereby expanding the genomic targeting range. We further demonstrate that a tandem single guide RNA (sgRNA) array expressed from a single transcript supports Un1Cas12f1-mediated multiplexed genome editing at up to five distinct genomic loci. Leveraging this multiplexing capability, we achieved targeted excision of the Dmd exon 23 through intramuscular delivery of an all-in-one AAV vector encoding Un1Cas12f1 and a CRISPR array. This treatment restored the disrupted open reading frame and dystrophin expression in a mouse model of Duchenne muscular dystrophy (DMD). Together, these findings establish Un1Cas12f1 as a compact CRISPR system capable of multiplexed genome editing and demonstrate its therapeutic potential for DMD.

Open article ↗



2026-09-08 | Duchenne muscular dystrophy: from gene to gene-ius therapies.

Duchenne muscular dystrophy (DMD) is a severe X-linked neuromuscular disorder caused by mutations in the dystrophin gene that result in the absence of functional dystrophin, leading to progressive muscle degeneration, loss of ambulation, respiratory failure, cardiomyopathy, and premature mortality. Despite advances in multidisciplinary supportive care, DMD remains an incurable disease associated with substantial physical, psychosocial, and economic burdens. The monogenic nature of DMD and its well-defined molecular pathogenesis have made it a prime target for the development of precision therapies aimed at restoring dystrophin expression or modifying disease progression. This review provides an overview of the genetic and molecular mechanisms underlying DMD, summarizes its clinical manifestations and natural history, and discusses current standards of care. It further examines recent advances in disease-modifying therapeutic strategies, including exon-skipping antisense oligonucleotides, nonsense mutation readthrough agents, adeno-associated virus (AAV)-mediated micro-dystrophin gene replacement, and emerging genome-editing technologies such as CRISPR/Cas9. The review also highlights the limitations of existing treatments, including mutation specificity, variable efficacy, immune-related challenges, and uncertainties regarding long-term durability and safety. Finally, it considers future directions in therapeutic development, emphasizing the need for combination approaches, improved delivery systems, and next-generation gene-editing platforms to achieve more effective and lasting clinical outcomes. Collectively, these advances represent a paradigm shift in DMD management and offer renewed hope for improving survival and quality of life for affected individuals.

Open article ↗



2026-09-03 | Creating bottom-up RNA transfer vehicles from synthetic protein assemblies.

Evolution guides biological systems to populate ecological niches, with viruses among the most successful examples of this principle. Viruses evolved over billions of years to efficiently transfer genetic information. Although viruses are highly diverse, most have converged towards remarkable similarity in the size and shape of their capsids1,2. By contrast, generative models for protein design enable the creation of protein architectures that are absent from nature3-5. Here we investigate whether protein assemblies designed by artificial intelligence can be functionalized to construct nucleic acid transport vehicles that are independent of evolutionary trajectories. By combining natural protein domains with synthetic protein assemblies, we create more than 100 bottom-up RNA transfer vehicles with unique sizes and shapes. These vehicles surpass the RNA transfer efficiency of widely used delivery vehicles by several orders of magnitude. In addition, we demonstrate that their tropism can be programmed by incorporation of computationally designed peptide binders and use them to deliver therapeutically relevant cargo RNAs into a wide range of cellular models. We show the in vivo biodistribution of one of these vehicles in a mouse at near-single-cell resolution, confirm its safety, and use it to perform a gene-editing treatment strategy for Duchenne muscular dystrophy in patient-derived cells and a pig. Our work demonstrates how proteins created by generative artificial intelligence can be harnessed for the rational engineering of RNA transport systems with the desired properties by overcoming the limitations of natural protein diversity.

Open article ↗



small molecules
2026-09-26 | Dystrophin Deficiency Creates a Pro-Ferroptotic Environment in Diaphragm of mdx Mice That Is Modified by Diet and Glucocorticoid Treatment.

Duchenne muscular dystrophy (DMD) is characterized by progressive muscle wasting with altered iron homeostasis and dysregulated lipid metabolism. Insulin resistance and obesity are common in DMD, but their impact on disease progression, particularly during glucocorticoid (GC) treatment, remains unclear. The role of ferroptosis, iron-dependent cell death, in DMD muscle pathology remains uncertain. We hypothesized that ferroptotic signaling would increase in mdx skeletal muscle, be further exacerbated by a high-fat, high-sucrose diet (HFHSD), and be attenuated by GC treatment. Male C57 and mdx mice were fed a control diet or HFHSD, with or without prednisolone, for 19 weeks before diaphragm western blot analysis. Dystrophic diaphragms had an increased abundance of transferrin (131%, p = 0.0006), transferrin receptor (72%, p = 0.0041), ferritin heavy chain (281%, p < 0.0001), acyl-CoA synthetase long-chain family member 4 (36%, p = 0.0080), and 5-lipoxygenase (101%, p = 0.0016) compared with C57. Despite these pro-ferroptotic changes, malondialdehyde and 4-hydroxynonenal were unchanged. Glutathione peroxidase 4 was robustly increased (800%, p < 0.0001), suggesting maintenance of redox balance and suppression of ferroptotic death. The HFHSD did not exacerbate ferroptotic signaling, whereas GC treatment partially offset disease-related changes in iron-handling and antioxidant proteins. These findings indicate that dystrophic diaphragms experience ferroptotic stress that is actively constrained, likely by compensatory GPX4 changes.

Open article ↗



2026-09-25 | A structured approach to address variability in the global management of adrenal insufficiency in Duchenne muscular dystrophy: the 2025 PJ Nicholoff steroid protocol.

Adrenal suppression is a potentially life-threatening consequence of chronic glucocorticoid (GC) therapy in Duchenne muscular dystrophy (DMD), placing individuals at risk for adrenal insufficiency and adrenal crisis during increased physiological stress, missed GC doses, abrupt discontinuation, or transitions between GC regimens. Management is increasingly complex because DMD treatment now includes multiple GC agents, including prednisone/prednisolone, deflazacort, and vamorolone, as well as daily, intermittent, and transition regimens that differ across countries and clinical settings. Although general principles of adrenal insufficiency prevention are well established, implementation remains challenging because of global variability in drug availability, institutional stress-steroid protocols, clinician experience, and caregiver education. This article discusses key sources of variability in adrenal suppression management for individuals with DMD and presents the 2025 PJ Nicholoff Steroid Protocol as an example of a practical, DMD-specific framework. The updated protocol incorporates newer therapies such as vamorolone and emphasizes anticipatory education, written stress-steroid plans (including a weight-based approach), safe GC tapering, confirmation of hypothalamic-pituitary-adrenal axis recovery, and careful management of transitions between GC agents and regimens. This structured approach aims to support safer and more consistent adrenal suppression management for individuals with DMD receiving chronic GC therapy through six critical concepts.

Open article ↗



2026-09-21 | Long-term imoxin treatment does not attenuate disease severity in dystrophic diaphragm of male mice.

Duchenne muscular dystrophy (DMD) is characterized by chronic skeletal muscle injury and degeneration. We discovered activation of protein kinase R (PKR; EIF2AK2), a regulator of the integrated stress response, in dystrophic muscle; however, its role in DMD remains unknown. We hypothesized that the PKR inhibitor imoxin (IMX) would improve muscle force and attenuate fibrosis, inflammatory signaling, and ER stress in diaphragms from mdx mice. C57 and mdx mice were treated with vehicle or IMX for ~24 wks (0.5 mg/kg, subcutaneous, 5 times/wk). Specific force was decreased (p < 0.001), and dynamic passive force was increased (p = 0.001) by disease, but there were no IMX effects. Disease-increased fibrotic area was decreased by IMX (p = 0.038); however, IMX failed to reduce fibronectin, collagen, or TGF-β1 signaling proteins. PKR and phosphorylated (p)PKR (thr446) were increased in mdx (p < 0.001) and maintained despite IMX treatment. Similarly, PKR regulators (total PACT, pPACT (ser18), TRBP, and PP1α), and PKR substrates (total eIF2α and peIF2α (ser51)) were also increased with disease (p < 0.001), but unaffected by IMX. Likewise, IMX did not attenuate disease-mediated elevations in inflammatory signaling and ER stress markers. Overall, the dose of IMX was insufficient to attenuate PKR activation and failed to improve muscle function or prevent pathology in dystrophic skeletal muscle.

Open article ↗



2026-09-20 | "Improving the beneficial effects of HDAC8 inhibition by simultaneously activation of SIRT1 in a zebrafish model of Duchenne muscular dystrophy.

Duchenne Muscular Dystrophy (DMD) is a severe genetic disorder characterized by progressive skeletal muscle degeneration, chronic inflammation, fibrosis, and mitochondrial dysfunction. Although gene- and cell-based therapies hold great promise, significant limitations still restrict their broad application, highlighting the need for complementary pharmacological approaches targeting secondary pathological mechanisms. Histone deacetylase (HDAC) inhibitors and Sirtuin 1 (SIRT1) activators represent promising therapeutic strategies, as HDAC8 is involved in cytoskeletal remodeling, whereas SIRT1 mainly regulates mitochondrial metabolism and energy homeostasis. In this study, we investigated the therapeutic efficacy of combining selective HDAC8 inhibition (PCI-34051) with SIRT1 activation (SRT2104) in a zebrafish model of DMD. Combined treatment significantly improved muscle structure and function, reduced inflammatory cell recruitment, and enhanced mitochondrial activity compared with single-drug administration. Importantly, comparable therapeutic efficacy was achieved using reduced doses of both compounds. Proteomic and acetylomic analyses revealed distinct but complementary molecular signatures induced by the two treatments. HDAC8 inhibition predominantly modulated pathways associated with cytoskeletal organization, epigenetic regulation, ribosome biogenesis, and muscle structural remodeling, whereas SIRT1 activation mainly affected mitochondrial function, oxidative metabolism, amino acid catabolism, and cellular bioenergetics. Overall, these findings demonstrate that combined HDAC8 inhibition and SIRT1 activation effectively ameliorate key pathological features of DMD in zebrafish and provide mechanistic insights into the complementary pathways targeted by the two compounds. This work supports the development of combinatorial epigenetic strategies as potential therapeutic approaches for DMD.

Open article ↗



2026-09-19 | β-hydroxy-β-methylbutyrate improves fast-twitch muscle function, histopathology and mitochondrial respiration in the D2.mdx dystrophic mouse.

Duchenne muscular dystrophy (DMD) is a severe inherited muscle disorder caused by mutations that eliminate the protein, dystrophin, resulting in disrupted protein homeostasis, mitochondrial dysfunction, chronic inflammation and progressive muscle degeneration. The leucine metabolite, β-hydroxy-β-methylbutyrate (HMB), has shown therapeutic potential in dystrophic muscle. We previously reported that HMB supplementation improves fast-twitch muscle histopathology and function in juvenile mdx mice during their peak damage phase (3-6 weeks). However, the mdx model exhibits a relatively mild pathology compared to human DMD, limiting clinical relevance. Here, we investigated 8 weeks of HMB supplementation (1 mg g-1 day-1 via drinking water) in the more severe D2.mdx mouse model at 3 and 6 months of age, representing skeletal muscle pathologies consistent with chronic inflammation and advanced muscle fibrosis, respectively. HMB-treated D2.mdx mice had improved grip strength compared to controls, whereas isolated fast-twitch extensor digitorum longus (EDL) muscles displayed increased fibre size, reduced tissue infiltrate and enhanced force production ex vivo. Mechanistically, HMB increased the phospho-to-total ratio of direct downstream mammalian target of rapamycin complex 1 (mTORC1) targets p70S6K1 and 4EBP1, consistent with enhanced anabolic signalling. Mitochondria assessed from treated flexor digitorum brevis muscles exhibited improved respiration and ATP production, with functional improvements aligning with elevated complex II succinate dehydrogenase activity in HMB-treated EDL muscles. By contrast, no significant HMB-induced effects were observed in the slow-twitch soleus muscle. This study is the first to demonstrate that HMB enhances in vivo and ex vivo muscle function, downstream mTORC1 signalling, and mitochondrial performance in the severe D2.mdx model, supporting its potential as a therapeutic strategy for DMD. KEY POINTS: β-Hydroxy-β-methylbutyrate (HMB) supplementation improves skeletal muscle function in the D2.mdx mouse model of Duchenne muscular dystrophy. HMB treatment increased voluntary grip strength and enhanced force production in isolated extensor digitorum longus extensor digitorum longus muscles in 3- and 6-month-old D2.mdx mice. Functional improvements were accompanied by reduced tissue infiltrate, increased mean muscle fibre size, and elevated succinate dehydrogenase activity. Τηεδδ adaptations coincided with increased markers of mammalian target of rapamycin complex 1 signalling, mitochondrial respiration and ATP production, suggesting improved metabolic capacity in dystrophic muscle.

Open article ↗



proteins
2026-08-20 | AAV9-mediated βIII-tubulin Ser172 phospho-mimic expression improves arrhythmic and inflammatory remodeling in dystrophic cardiomyopathy.

Duchenne muscular dystrophy (DMD) cardiomyopathy is characterized by progressive microtubule remodeling, connexin-43 (Cx43) dysregulation, and ventricular arrhythmias. We previously demonstrated phospho-mimic knock-in of βIII-tubulin S172E preserves microtubule organization and attenuates cardiac pathology in mdx mice. However, whether these protective effects can be reproduced using a clinically relevant gene-delivery strategy remains unknown. We generated a cardiomyocyte-specific adeno-associated virus serotype 9 (AAV9) vector expressing phospho-mimic βIII-tubulin (Tubb3-S172E) under the cardiac troponin T promoter and delivered it to 4-5-month-old wild-type and mdx mice. Cardiac Tubb3-S172E expression was confirmed by quantitative qPCR and immunoblotting. In mdx mice, AAV9-mediated Tubb3-S172E expression significantly reduced mononuclear inflammatory infiltration, restored Cx43 localization at intercalated discs, and attenuated isoproterenol-induced arrhythmia susceptibility. In contrast, cardiac fibrosis, Nav1.5 protein expression, and peak sodium current density were not significantly improved. Overexpression of wild-type βIII-tubulin in healthy hearts increased Cx43 lateralization and arrhythmia susceptibility, indicating that βIII-tubulin phosphorylation state rather than protein abundance determines its protective function. Cardiomyocyte-targeted delivery of phospho-mimic βIII-tubulin partially recapitulates the protective effects observed in the genetic S172E knock-in model. These findings identify βIII-tubulin Ser172 phosphorylation as a critical regulator of microtubule-dependent electrical remodeling and support therapeutic modulation of this pathway in Duchenne muscular dystrophy cardiomyopathy. Cardiomyocyte-targeted AAV9 delivery of phospho-mimic âIII-tubulin improves Cx43 organization, inflammatory remodeling, and arrhythmia susceptibility in dystrophic hearts, demonstrating that therapeutic modulation of βIII-tubulin Ser172 phosphorylation partially recapitulates the protective effects observed in the genetic S172E model.The dissociation between improved electrical remodeling and persistent Nav1.5 and fibrotic abnormalities suggests that βIII-tubulin Ser172 phosphorylation selectively regulates specific microtubule-dependent pathological pathways in dystrophic cardiomyopathy.Future studies should define the molecular mechanisms linking βIII-tubulin Ser172 phosphorylation to cardiomyocyte-immune cell communication and determine how this pathway coordinates electrical and inflammatory remodeling in dystrophic hearts.

Open article ↗



2026-08-14 | Lipin1 restores nNOS sarcolemmal localization and improves fatigue resistance in Duchenne muscular dystrophy.

In Duchenne muscular dystrophy (DMD), nNOS is mislocalized from the sarcolemmal membrane and exhibits reduced expression and activity, impairing vasomodulation and contributing to increased muscle fatigue. Identification of upstream regulators that restore nNOS localization and function may provide therapeutic strategies to improve muscle performance in dystrophic muscle. In this study, we investigated the role of lipin1 in regulating nNOS expression, sarcolemmal localization, and NOS activity in skeletal muscle. Lipin1 deficiency significantly reduced nNOS expression and total NOS enzymatic activity, whereas lipin1 overexpression enhanced these parameters. Skeletal muscle-specific lipin1 knockout mice (lipin1Myf5cKO) exhibited increased muscle fatigue, consistent with impaired nNOS-dependent muscle function. In contrast, transgenic lipin1 restoration in dystrophic muscle (mdx:lipin1Tg/0) restored nNOS expression and sarcolemmal localization and improved fatigue resistance. Our findings suggest that lipin1 promotes nNOS sarcolemmal localization, potentially through stabilization of membrane-associated protein complexes, and enhances nNOS expression through a lipin1/DAG/PKD/CREB signaling axis. Collectively, these findings identify lipin1 as an important regulator of nNOS expression and localization in skeletal muscle and support lipin1 restoration as a potential therapeutic strategy for DMD.

Open article ↗



2026-08-10 | Reduced Cx43 S-nitrosylation protects against cardiac stress-induced arrhythmias and myocardial injury in Duchenne Muscular Dystrophy.

In Duchenne muscular dystrophy (DMD), connexin-43 (Cx43) delocalizes from intercalated discs to the lateral membrane of cardiomyocytes, where it forms undocked hemichannels. β-adrenergic stress induces lethal arrhythmias in DMDmdx mice that correlate with increased Cx43 S-nitrosylation and excessive hemichannel opening. Here, we aimed to determine whether S-nitrosylation of Cx43 at cysteine 271 directly contributes to β-adrenergic stress-induced arrhythmias and myocardial injury in DMD. To define the role of Cx43 S-nitrosylation in DMD cardiomyopathy, we generated DMDmdx knock-in mice carrying a cysteine-to-serine substitution at residue 271, a critical S-nitrosylation site involved in NO-dependent Cx43 hemichannel activation (DMDmdx:C271S+/-). Following β-adrenergic stimulation, DMDmdx mice exhibited a higher incidence of arrhythmogenic events and increased triggered activity in isolated cardiomyocytes compared with DMDmdx:C271S+/- mice, which more closely resembled wild-type mice. Optical mapping of isolated hearts showed that DMDmdx mice developed abnormal Ca2+ transients, prolonged action potentials, and episodes of conduction block. These abnormalities were normalized in DMDmdx:C271S+/- mice and attenuated by treatment with the Cx43 hemichannel inhibitor Gap19. Moreover, β-adrenergic stress evoked severe myocardial injury and bradycardia in DMDmdx mice, both of which were significantly attenuated in DMDmdx:C271S+/- mice. Notably, Gap19-treated DMDmdx mice were protected against myocardial injury, further supporting a direct role for Cx43 hemichannels in DMD-associated cardiac damage. These findings reveal, for the first time, a mechanistic link between Cx43 hemichannel activity, arrhythmogenesis, and myocardial injury in DMD. We conclude that S-nitrosylation of Cx43 is a fundamental NO-mediated mechanism driving β-adrenergic stress-induced arrhythmias and myocardial injury in DMDmdx mice through pathological opening of Cx43 hemichannels.

Open article ↗



2026-06-25 | The Multi-System Roles of Dp71 Dystrophin Isoforms in Duchenne Muscular Dystrophy.

The DMD gene is best known for its product dystrophin, a large rod-shaped protein that plays a critical role in muscular membrane strength and integrity. Mutations affecting dystrophin lead to Duchenne muscular dystrophy, a fatal X-linked disease characterized by muscular weakness and breakdown. In addition to the full-length dystrophin product that is most often associated with disease, the DMD gene also encodes multiple shorter isoforms of dystrophin with diverse functions. One isoform in particular, Dp71, has been increasingly found to play a wide variety of roles throughout the body. In this narrative review, we consolidate the numerous studies on Dp71 to provide a comprehensive foundation for future work. We outline and summarize the current state of knowledge on the role of Dp71 in the brain, the retina, and skeletal muscles, identifying current knowns and unknowns in the field. We also explore Dp71-based therapies currently being tested in the pre-clinical landscape and identify potential limitations for clinical translation.

Open article ↗



2026-06-22 | High-throughput discovery of arginine-depleted peptides enables effective antisense delivery for Duchenne muscular dystrophy.

Phosphorodiamidate morpholino oligomers (PMOs) are approved exon-skipping antisense therapeutics for Duchenne muscular dystrophy (DMD), but their clinical utility is limited by poor uptake in muscle tissue, necessitating frequent high-dose administration. Cell-penetrating peptides (CPPs) can enhance intracellular delivery of PMOs, yet conventional arginine-rich CPPs often cause dose-limiting toxicity, including renal damage, which hinders their clinical translation. To address this challenge, we developed a high-throughput, charge-based chromatographic enrichment platform capable of screening over 15,000 synthetic peptides, including sequences with noncanonical (abiotic) amino acids. This approach enabled de novo discovery of arginine-depleted CPPs with improved delivery profiles. Four lead candidates demonstrated efficient nuclear PMO delivery with ~10-fold lower in vitro toxicity compared to standard CPPs such as penetratin. The top-performing peptide, CXP1, showed robust splice-switching activity and favorable tolerability in both cellular and animal models. In dystrophic mdx mice, CXP1-PMO conjugates achieved greater exon skipping compared to PMOs conjugated to R6G at equivalent doses. Tissue levels of CXP1-PMO correlated with exon-skipping efficacy, establishing a clear pharmacokinetic-pharmacodynamic relationship. These findings highlight a mechanistically novel and translationally relevant discovery strategy, demonstrating the potential of high-throughput platforms to generate more effective CPP-based delivery vehicles for antisense therapeutics in DMD and related neuromuscular disorders.

Open article ↗



oligonucleotides
2026-08-21 | Four new mouse models of Duchenne muscular dystrophy with clinically relevant exon deletions in the human DMD gene.

Variant-specific therapeutic approaches, such as exon skipping or gene editing, hold promise for the treatment of Duchenne muscular dystrophy (DMD). Translatability of preclinical studies investigating these approaches could greatly be improved through the use of humanized mouse models, as these allow preclinical testing of human-specific sequences. We developed four novel humanized mouse models of DMD with a deletion of exon 44, 45, 51 or 53 in the human DMD gene, in a mouse dystrophin-negative background (mdx mouse; exon 23 nonsense mutation). Our optimized prescreening pipeline allowed us to do so very efficiently with the CRISPR-Cas9 technology. We confirmed either complete lack of dystrophin or expression of trace levels, which led to development of muscle pathology consisting of muscle fiber degeneration and regeneration, inflammation and fibrosis in young adult mice. Intramuscular treatment with vivo-morpholinos targeting a flanking exon induced exon skipping in the DMD strains, which restored the disrupted open reading frame and, subsequently, dystrophin expression. This validates these models as valuable tools for preclinical studies investigating human sequence-specific therapeutic approaches for DMD.

Open article ↗



2026-07-15 | AI-powered therapeutic aptamer drug discovery: Targeting the CT-domain of CTGF for duchenne muscular dystrophy.

Duchenne muscular dystrophy (DMD), a fatal X-linked disorder, features progressive muscle fibrosis as a key driver of mortality. While CTGF represents a therapeutic target for DMD, its VWC-domain-targeting antibody (FG-3019) failed in clinical trials. Through experimental validation, we identified CT-domain as a superior target domain, as it contributed more fibrosis activity of CTGF than VWC-domain without elevating compensatory TGF-β1 level. Aptamers are synthetic oligonucleotides identified through SELEX, which can specifically bind to flexible protein domains through their unique 3D conformations. Their small molecular size enables effective tissue penetration while maintaining high target specificity, making them ideal CT-domain inhibitors. Nevertheless, conventional SELEX involves time-consuming and inefficient multiple screening rounds. Here, we employed our generative AI model, AptGEN, to rapidly discover a potent CT-domain specific aptamer within 42 days. This chemically modified aptamer (Apc003OA) distributed and remained in muscle tissues for an extended period, whereas FG-3019 could not. Importantly, it demonstrated better fibrosis inhibitory activity in vitro and in mdx mice when compared to FG-3019. Furthermore, Apc003OA demonstrated a favorable safety profile in mdx mice. Within 10 months, we progressed from target domain discovery, aptamer drug discovery, and then obtained both Orphan Drug Designation and Pediatric Rare Disease Designation by US Food and Drug Administration.

Open article ↗



2026-07-13 | CPP2Vec: A representation learning approach for cell-penetrating peptides prediction.

Cell-penetrating peptides (CPPs) facilitate the delivery of a variety of therapeutic molecules across the plasma membrane, from small chemical substances to nucleic acid-based macromolecules, such as antisense oligonucleotides (ASOs). Among neutral ASOs, peptide nucleic acids (PNAs) and phosphorodiamidate morpholino oligomers (PMOs) have been extensively studied as potential medical treatments for Duchenne Muscular Dystrophy (DMD), a severe genetic disease that causes muscle degeneration progressively. Over the last few decades, many in silico methods have emerged to detect novel CPPs, counterbalancing the cost of wet-lab experiments. In this study, we propose CPP2Vec, a Word2Vec-based CPP prediction method, where the Word2Vec technique is used to represent amino acid sequences of peptides. To address the limited sequence diversity, sparse biological grounding, and the still poorly understood mechanisms underlying CPPs uptake, we constructed CPP2Vec-GenSet, a hybrid dataset that integrates computationally generated peptides with experimentally curated CPPs. This combined resource provides a robust training foundation that supports reliable representation learning and enhances cross-task model performance. Using this framework, we developed three task-specific supervised machine learning models for CPP-Classification, Uptake-Efficiency and PMO-Delivery. The first two models were designed to determine if an unseen peptide is a CPP and to predict its uptake efficiency, respectively, while the PMO-Delivery model predicts whether a peptide could enhance the cellular delivery of a PMO-complex compared to its naked version. Furthermore, we explored an alternative approach using pre-trained protein-based Large Language Models (LLMs) - ProtT5, ProtBERT, and ESM-2 - to generate the embeddings, resulting in three task-specific models, namely CPP2LLM. Benchmarking against state-of-the-art CPP prediction tools demonstrates that CPP2Vec achieves robust predictive performance and generalization across tasks, while maintaining exceptional computational efficiency. In this research, we present a Machine Learning (ML)-based tool that introduces the use of the Word2Vec technique in the field of CPPs prediction. Notably, CPP2Vec automatically learns informative peptide representations directly from sequence data, generalizes reliably across multiple tasks, and achieves high predictive performance with minimal computational resources, providing a reproducible and practical in silico tool to support the early-stage identification and prioritization of CPPs with potential therapeutic relevance. CPP2Vec is available for use at: https://github.com/SSvolou/CPP2Vec.

Open article ↗



2026-06-06 | A Real-World Target Trial Emulation of Eteplirsen, Casimersen, and Golodirsen to Evaluate Survival Among Patients with Duchenne Muscular Dystrophy.

Real-world data are needed to understand the treatment effect of eteplirsen, casimersen, and golodirsen (phosphorodiamidate morpholino oligomers [PMOs]) on all-cause mortality in patients with DMD. The study objectives were to describe the unadjusted time to death from treatment start and from birth, assess PMO treatment's impact on survival, and describe the frequency of comorbidities prior to death. Sequential target trial emulation with inverse probability of treatment and censoring weighting were used to compare survival between patients who received glucocorticoids (GCs) and eteplirsen, casimersen, or golodirsen (PMO + GCs) or GCs alone (GCs-only). Inovalon closed claims data (January 2016-September 2024) were tokenized and linked with Datavant mortality data. In the PMO + GCs group, 208/372 (56%) received eteplirsen, 123/372 (33%) casimersen, and 41/372 (11%) golodirsen. Twelve of 372 patients (3%) died after treatment initiation with PMO + GCs versus 114/2656 (4%) for GCs-only without adjustment for confounding or length of follow-up. In the adjusted target trial emulation analysis, 112 patients initiated PMOs and 2916 initiated GCs-only treatment in the first trial; median follow-up time was 4.6 and 4.8 years, respectively. In sequential trials, 260/2916 patients originally in the GCs-only group initiated treatment with PMOs. While the mortality rate in both groups was low, data from 48 sequentially emulated trials estimated PMO + GCs reduced mortality risk versus GCs-only (hazard ratio 0.303; 95% confidence interval 0.119-0.769; P = 0.012). In patients from either group with claims in the 3 months preceding death (n = 84), more than 75% had circulatory/respiratory claims. The relative risk reduction in mortality suggests a promising treatment effect of PMO + GCs versus GCs-only, which should be confirmed in future studies with longer follow-up.

Open article ↗



2026-04-22 | Transforming Duchenne muscular dystrophy therapy: The multifaceted role of extracellular vesicles and exosomes.

Duchenne muscular dystrophy (DMD) remains a devastating X chromosome-linked disorder with restricted curative options. Additionally, the existing treatment approaches, such as growth-modulating agents, anti-inflammatory drugs, antisense oligonucleotides with exon-skipping capabilities, stop codon mutation suppressors, vector-mediated gene therapy, CRISPR/Cas9 gene editing, and exogenous cell transplantation, can delay disease progression but are not curative. Extracellular vesicles (EVs), especially exosomes, nanoscale vesicles involved in intercellular communication, have emerged as promising therapeutic tools for DMD due to their low immunogenicity, ability to deliver therapeutic cargos, and potential to modulate inflammation, oxidative stress, and fibrosis. This review explores the transformative role of EVs (including exosomes) as multifunctional tools in DMD management. Natural EVs, enriched with regenerative microRNAs (miRNAs) and anti-fibrotic proteins, modulate inflammation, oxidative stress, and muscle degeneration. Besides, innovative engineering approaches could improve EVs' cargo loading and targeting, assisting efficient delivery of oligonucleotides and CRISPR/Cas9 editing components. Furthermore, we address the capacity of these vesicles to restore dystrophin expression and attenuate pathogenic mechanisms. Lastly, challenges associated with EV isolation, stability, and scalability are critically evaluated to support the development of an integrated cell and gene therapy framework with significant potential to improve clinical outcomes in DMD patients.

Open article ↗



other
2026-09-25 | Gene-Corrected Human iPSC-Derived Cardiomyocytes and Skeletal Muscles Reveal Partial Dystrophin Dp427 Preservation and Cardiac Dp116 Expression in Duchenne Muscular Dystrophy Patient With a Splice-Site Mutation in Intron 68 (c.9975-1G>T).

Duchenne muscular dystrophy (DMD) is a severe X-linked neuromuscular disease caused by mutations in the DMD gene, leading to the absence or dysfunction of dystrophin. Although cardiac and skeletal muscles are both affected, tissue-specific differences in disease manifestation and dystrophin regulation remain poorly understood. To investigate these differences, we established a human induced pluripotent stem cell model of DMD from peripheral blood mononuclear cells of a patient (DMD patient with a point mutation in intron 68 (c.9975-1G>T) investigated in the study [DMB15]) carrying a splice-site mutation in intron 68 (c.9975-1G>T). An isogenic control line was generated via clustered regularly interspaced short palindromic repeats/clustered regularly interspaced short palindromic repeats-associated protein 9 correction. Both repaired and DMD human induced pluripotent stem cells were differentiated into cardiomyocytes (DMB15-CMs) and skeletal muscle cells (DMB15-derived skeletal muscle cells); the skeletal muscle lineage included a myoblast (DMB15-derived myoblasts) stage. Transcript and protein analyses were performed, along with functional assessments using microelectrode array recordings and calcium handling analysis. Transcript analysis revealed an in-frame deletion of 2 amino acids (Tyr3325 and Arg3326) due to skipping of the first 6 nucleotides of exon 69. Despite this, near full-length Dp427 (full-length dystrophin isoform of 427 kDa) was detected by Western blot, along with expression of Dp116 (dystrophin isoform of 116 kDa) in DMB15-CMs. Dystrophin levels were preserved in DMD DMB15-CMs but markedly reduced in DMB15-derived skeletal muscle cells, suggesting tissue-specific regulation. Analysis of DMB15-derived myoblasts demonstrated possible changes in myogenic program activation, alongside inconsistent expression of utrophin, the dystrophin paralogue. Functional analysis showed altered β-adrenergic responsiveness in DMD DMB15-CMs, with increased beating frequency and accelerated repolarization on isoproterenol stimulation. DMB15-CMs showed largely preserved basal Ca2+ cycling but failed to maintain a normal amplitude response under β-adrenergic stimulation. Our study identifies a splice-site DMD gene mutation that preserves high levels of dystrophin expression in cardiac muscle but reduced in skeletal muscle and reveals Dp116 expression in cardiomyocytes. These findings highlight the importance of tissue context in DMD and demonstrate the power of human induced pluripotent stem cell-based systems for dissecting mutation-specific effects.

Open article ↗



2026-07-30 | Deramiocel heart-derived cellular therapy in advanced Duchenne muscular dystrophy (HOPE-3): a phase 3, randomised, double-blind, placebo-controlled trial.

Duchenne muscular dystrophy (DMD) is an X-linked genetic disease of skeletal and cardiac muscle that leads to loss of ambulation and premature death due to progressive myopathy and cardiomyopathy. Deramiocel, a heart-derived cellular therapy consisting of human allogeneic cardiosphere-derived cells, improved cardiac and skeletal muscle function in phase 1-2 studies of DMD. Our aim was to assess the efficacy and safety of deramiocel in advanced DMD and support the findings of HOPE-2. HOPE-3, a phase 3, multicentre, randomised (1:1), double-blind, placebo-controlled study, included participants aged 10 years or older with DMD. Investigational product was infused intravenously every 3 months in outpatient settings. Skeletal and cardiac function was evaluated at 12 months. The primary endpoint was total Performance of the Upper Limb 2.0 (PUL2.0) percentage change from baseline. The trial is registered with ClinicalTrials.gov (NCT05126758). Between June 22, 2022, and May 28, 2024, 139 participants were screened, of whom 106 were randomly assigned to deramiocel (n=54) or placebo (n=52), and included in the intention-to-treat population. The primary endpoint showed significant improvements in the deramiocel group versus placebo. For total PUL2.0, least-squares mean percentage change at 12 months favoured deramiocel by 4·55% (95% CI 0·47-8·63; p=0·029). The safety profile of deramiocel was similar to that of placebo. Deramiocel safely slows disease progression in advanced DMD, preserving skeletal muscle function. Administered quarterly in a simple outpatient regimen, deramiocel is a promising treatment for DMD, agnostic to the precise underlying genetic lesion. Capricor Therapeutics.

Open article ↗



2026-07-27 | Engineered exosomes improve myocardial cell membrane integrity and heart function in dystrophic cardiomyopathy.

Duchenne muscular dystrophy (DMD)-associated cardiomyopathy is a leading causes of premature death, yet treatment options remain limited. In this study, we developed the easily accessible engineered exosomes for treatment of DMD-associated cardiomyopathy and explored the underlying mechanisms in DmdΔ4 mice, a model harboring hot spot mutation in the dystrophin gene. DmdΔ4 mice and their cardiomyopathy phenotype were confirmed by Sanger sequencing, pathological staining, flow cytometry, immunoblotting, single-cell sequencing and echocardiographic analysis. Engineered exosomes, exosomes- cardiac homing peptide (Exo-CHP), were synthesised and characterised by click chemistry and miRNA sequence, separately. The targeted ability and the therapeutic effects of Exo-CHP were studied in vitro and in vivo. Primary cardiomyocytes were used to study the underlying mechanism of Exo-CHP. DmdΔ4 mice showed an obvious cardiomyopathy-associated phenotype. Exo-CHP can target myocardium and mitigate pathological progression of cardiomyopathy in DmdΔ4 mice. The therapeutic effects of intravenously delivered Exo-CHP significantly reduced myocardial inflammation, fibrosis and improved the mice's cardiac function. The rescue effects were mediated through the regulation of gene expression at the transcriptomic level, prevention of dystrophin protein complex degradation, and inhibition of intracellular calcium influx and calpain protease activity. The miR-21 knockdown Exo-CHP can counteract the protective effects of Exo-CHP on the calcium content and membrane integrity of primary DmdΔ4-derived cardiomyocytes. Our study demonstrated the feasibility, efficacy and the possible mechanism of mesenchymal stromal cell-derived engineered exosomes, positioning them as a potential cell-free intervention for DMD-associated cardiomyopathy.

Open article ↗



2026-06-12 | Skeletal-muscle-targeted non-viral delivery of full-length DMD mRNA for Duchenne muscular dystrophy.

Duchenne muscular dystrophy (DMD) is a severe, progressive muscle-wasting disorder caused by mutations in the DMD gene, which encodes dystrophin. Although gene therapy using viral vectors has shown promise for the treatment of DMD, the clinical application of viral gene therapies is limited by vector toxicity, immunogenicity and the inability to package full-length dystrophin. Recent advances in messenger RNA (mRNA) technology offer a non-integrating, transient approach to restoring protein expression. Here we report the systemic delivery of skeletal-muscle-targeted full-length DMD mRNA in a murine model of DMD using allogenically engineered targeting extracellular vesicles (DMD t-EVs). This approach restores the endogenous translation of wild-type dystrophin and substantially improves muscle function. We further demonstrate the safety and biocompatibility of DMD t-EVs in non-human primates, supporting their translational potential. These findings highlight the promise of mRNA-loaded extracellular vesicles as a therapeutic platform for treating genetic disorders involving large, difficult-to-package genes.

Open article ↗



2026-06-04 | Microbiota dysbiosis influences immune system and muscle pathophysiology of dystrophin deficient mice.

Duchenne muscular dystrophy (DMD) is a progressive, severe muscle-wasting disease caused by mutations in DMD, encoding dystrophin, that leads to loss of muscle function with cardiac/respiratory failure and premature death. Since dystrophic muscles are sensed by infiltrating inflammatory cells, and gut microbial communities can cause immune dysregulation and metabolic syndrome, we sought to investigate whether intestinal bacteria support the muscle immune response in the mdx dystrophic murine model. We highlighted a strong correlation between DMD disease features and the relative abundance of Prevotella. Furthermore, the absence of gut microbes through the generation of mdx germ-free animal model, as well as modulation of the microbial community structure by antibiotic treatment, influenced muscle immunity and fibrosis. Intestinal colonization of mdx mice with eubiotic microbiota was sufficient to reduce inflammation and improve muscle pathology and function. This work identifies a potential role for the gut microbiota in the pathogenesis of DMD.

Open article ↗



gene therapies
2026-09-24 | RNA trans-splicing treatment for Duchenne muscular dystrophy.

Duchenne muscular dystrophy (DMD) is a fatal disorder caused by dystrophin mutations, leading to progressive muscle degeneration and cardiac failure. Although AAV-based DMD therapies with innovative designs to overcome the cargo limits of the virus are effective in animal models, these current systems may face clinical translation challenges related to efficiency, off-target effects, and immunogenicity. We developed a multi-vector RNA End Joining (REJ) system to split large genes into multiple co-delivered AAVs that engage the cell's intrinsic spliceosome to precisely reassemble RNA segments that encode very large scar-free proteins. We show the system is efficient and has negligible off-target interactions. In vivo , REJ vectors expressing the adenine base editor Abe8e, mini-dystrophin Dp253, or native full-length dystrophin Dp427 each prevented muscle degeneration. Machine-learning histopathology of more than 120,000 myofibers revealed robust reductions in nuclear infiltration, improved centronucleation, and normalized hypertrophy, supported by functional, transcriptomic, and behavioral analyses. These findings establish REJ as a clinically viable AAV-based strategy for DMD that enables expression of large therapeutic proteins while avoiding potentially antigenic bacterial protein- or DNA-recombinases.

Open article ↗



2026-09-16 | Development of an AAV-Encoded Adenine Base Editor for Duchenne Muscular Dystrophy.

Duchenne muscular dystrophy (DMD) is a devastating X-linked disorder caused by out-of-frame mutations in the DMD gene, most commonly large deletions or duplications, as well as nonsense and splice site mutations, that result in the absence of functional dystrophin protein. These mutations lead to progressive skeletal and cardiac muscle failure. In particular, exon 52 of the DMD gene represents a mutational hotspot in DMD patients. Deletion of exon 52 (DMDΔ52) disrupts the reading frame, leading to premature termination of translation. Here, we used a dual recombinant adeno-associated virus (rAAV) system employing an intein-mediated split strategy to deliver ABE8e using the PAM-less SpRY Cas9 nickase for adenine base editing of splice acceptor sites (SAS) in the dystrophin gene. Targeting the SAS of exon 51 or exon 53 in a DMDΔ52 background aims to induce exon skipping, thereby restoring the open reading frame, in effect converting the severe DMD phenotype into a milder Becker muscular dystrophy (BMD)-like phenotype. We systematically screened sgRNAs in porcine kidney fibroblasts and human embryonic kidney cells (HEK293T), identifying a guide RNA targeting the SAS of exon 53 as the most effective candidate with high on-target editing efficacies and minimal bystander editing. In human DMDΔ52 iPSC-derived cardiomyocytes cultivated as 2D monolayers, high editing efficiencies were achieved with the optimized 1:2 ratio of N-Terminus to C-Terminus. Functional assessment in 3D engineered heart patches revealed a trend toward normalization of the arrhythmic DMD phenotype with an increase in the effective refractory period (ERP) and a reduction in arrhythmic load compared with untreated DMD patches, despite lower editing efficacy in the 3D setting. These findings suggest that even modest levels of base editing-mediated exon skipping may ameliorate the DMD cardiac phenotype toward a BMD-like state, supporting the translational potential of this dual rAAV base editing approach for DMD cardiomyopathy.

Open article ↗



2026-09-11 | Multiplexed genome editing by CRISPR-Un1Cas12f1 restores dystrophin expression in a mouse model of Duchenne muscular dystrophy.

The compact type V clustered regularly interspaced short palindromic repeats (CRISPR) nuclease Un1Cas12f1 is compatible with adeno-associated virus (AAV)-mediated genome editing, although the protospacer adjacent motif (PAM) requirements and capacity for multiplexed genome editing remain undefined. Here, we show that Un1Cas12f1 exhibits a broad tolerance for non-canonical PAMs, including Y-rich motifs with a preference for TTCR and TCTA PAMs, thereby expanding the genomic targeting range. We further demonstrate that a tandem single guide RNA (sgRNA) array expressed from a single transcript supports Un1Cas12f1-mediated multiplexed genome editing at up to five distinct genomic loci. Leveraging this multiplexing capability, we achieved targeted excision of the Dmd exon 23 through intramuscular delivery of an all-in-one AAV vector encoding Un1Cas12f1 and a CRISPR array. This treatment restored the disrupted open reading frame and dystrophin expression in a mouse model of Duchenne muscular dystrophy (DMD). Together, these findings establish Un1Cas12f1 as a compact CRISPR system capable of multiplexed genome editing and demonstrate its therapeutic potential for DMD.

Open article ↗



2026-09-08 | Duchenne muscular dystrophy: from gene to gene-ius therapies.

Duchenne muscular dystrophy (DMD) is a severe X-linked neuromuscular disorder caused by mutations in the dystrophin gene that result in the absence of functional dystrophin, leading to progressive muscle degeneration, loss of ambulation, respiratory failure, cardiomyopathy, and premature mortality. Despite advances in multidisciplinary supportive care, DMD remains an incurable disease associated with substantial physical, psychosocial, and economic burdens. The monogenic nature of DMD and its well-defined molecular pathogenesis have made it a prime target for the development of precision therapies aimed at restoring dystrophin expression or modifying disease progression. This review provides an overview of the genetic and molecular mechanisms underlying DMD, summarizes its clinical manifestations and natural history, and discusses current standards of care. It further examines recent advances in disease-modifying therapeutic strategies, including exon-skipping antisense oligonucleotides, nonsense mutation readthrough agents, adeno-associated virus (AAV)-mediated micro-dystrophin gene replacement, and emerging genome-editing technologies such as CRISPR/Cas9. The review also highlights the limitations of existing treatments, including mutation specificity, variable efficacy, immune-related challenges, and uncertainties regarding long-term durability and safety. Finally, it considers future directions in therapeutic development, emphasizing the need for combination approaches, improved delivery systems, and next-generation gene-editing platforms to achieve more effective and lasting clinical outcomes. Collectively, these advances represent a paradigm shift in DMD management and offer renewed hope for improving survival and quality of life for affected individuals.

Open article ↗



2026-09-03 | Creating bottom-up RNA transfer vehicles from synthetic protein assemblies.

Evolution guides biological systems to populate ecological niches, with viruses among the most successful examples of this principle. Viruses evolved over billions of years to efficiently transfer genetic information. Although viruses are highly diverse, most have converged towards remarkable similarity in the size and shape of their capsids1,2. By contrast, generative models for protein design enable the creation of protein architectures that are absent from nature3-5. Here we investigate whether protein assemblies designed by artificial intelligence can be functionalized to construct nucleic acid transport vehicles that are independent of evolutionary trajectories. By combining natural protein domains with synthetic protein assemblies, we create more than 100 bottom-up RNA transfer vehicles with unique sizes and shapes. These vehicles surpass the RNA transfer efficiency of widely used delivery vehicles by several orders of magnitude. In addition, we demonstrate that their tropism can be programmed by incorporation of computationally designed peptide binders and use them to deliver therapeutically relevant cargo RNAs into a wide range of cellular models. We show the in vivo biodistribution of one of these vehicles in a mouse at near-single-cell resolution, confirm its safety, and use it to perform a gene-editing treatment strategy for Duchenne muscular dystrophy in patient-derived cells and a pig. Our work demonstrates how proteins created by generative artificial intelligence can be harnessed for the rational engineering of RNA transport systems with the desired properties by overcoming the limitations of natural protein diversity.

Open article ↗



small molecules
2026-09-26 | Dystrophin Deficiency Creates a Pro-Ferroptotic Environment in Diaphragm of mdx Mice That Is Modified by Diet and Glucocorticoid Treatment.

Duchenne muscular dystrophy (DMD) is characterized by progressive muscle wasting with altered iron homeostasis and dysregulated lipid metabolism. Insulin resistance and obesity are common in DMD, but their impact on disease progression, particularly during glucocorticoid (GC) treatment, remains unclear. The role of ferroptosis, iron-dependent cell death, in DMD muscle pathology remains uncertain. We hypothesized that ferroptotic signaling would increase in mdx skeletal muscle, be further exacerbated by a high-fat, high-sucrose diet (HFHSD), and be attenuated by GC treatment. Male C57 and mdx mice were fed a control diet or HFHSD, with or without prednisolone, for 19 weeks before diaphragm western blot analysis. Dystrophic diaphragms had an increased abundance of transferrin (131%, p = 0.0006), transferrin receptor (72%, p = 0.0041), ferritin heavy chain (281%, p < 0.0001), acyl-CoA synthetase long-chain family member 4 (36%, p = 0.0080), and 5-lipoxygenase (101%, p = 0.0016) compared with C57. Despite these pro-ferroptotic changes, malondialdehyde and 4-hydroxynonenal were unchanged. Glutathione peroxidase 4 was robustly increased (800%, p < 0.0001), suggesting maintenance of redox balance and suppression of ferroptotic death. The HFHSD did not exacerbate ferroptotic signaling, whereas GC treatment partially offset disease-related changes in iron-handling and antioxidant proteins. These findings indicate that dystrophic diaphragms experience ferroptotic stress that is actively constrained, likely by compensatory GPX4 changes.

Open article ↗



2026-09-25 | A structured approach to address variability in the global management of adrenal insufficiency in Duchenne muscular dystrophy: the 2025 PJ Nicholoff steroid protocol.

Adrenal suppression is a potentially life-threatening consequence of chronic glucocorticoid (GC) therapy in Duchenne muscular dystrophy (DMD), placing individuals at risk for adrenal insufficiency and adrenal crisis during increased physiological stress, missed GC doses, abrupt discontinuation, or transitions between GC regimens. Management is increasingly complex because DMD treatment now includes multiple GC agents, including prednisone/prednisolone, deflazacort, and vamorolone, as well as daily, intermittent, and transition regimens that differ across countries and clinical settings. Although general principles of adrenal insufficiency prevention are well established, implementation remains challenging because of global variability in drug availability, institutional stress-steroid protocols, clinician experience, and caregiver education. This article discusses key sources of variability in adrenal suppression management for individuals with DMD and presents the 2025 PJ Nicholoff Steroid Protocol as an example of a practical, DMD-specific framework. The updated protocol incorporates newer therapies such as vamorolone and emphasizes anticipatory education, written stress-steroid plans (including a weight-based approach), safe GC tapering, confirmation of hypothalamic-pituitary-adrenal axis recovery, and careful management of transitions between GC agents and regimens. This structured approach aims to support safer and more consistent adrenal suppression management for individuals with DMD receiving chronic GC therapy through six critical concepts.

Open article ↗



2026-09-21 | Long-term imoxin treatment does not attenuate disease severity in dystrophic diaphragm of male mice.

Duchenne muscular dystrophy (DMD) is characterized by chronic skeletal muscle injury and degeneration. We discovered activation of protein kinase R (PKR; EIF2AK2), a regulator of the integrated stress response, in dystrophic muscle; however, its role in DMD remains unknown. We hypothesized that the PKR inhibitor imoxin (IMX) would improve muscle force and attenuate fibrosis, inflammatory signaling, and ER stress in diaphragms from mdx mice. C57 and mdx mice were treated with vehicle or IMX for ~24 wks (0.5 mg/kg, subcutaneous, 5 times/wk). Specific force was decreased (p < 0.001), and dynamic passive force was increased (p = 0.001) by disease, but there were no IMX effects. Disease-increased fibrotic area was decreased by IMX (p = 0.038); however, IMX failed to reduce fibronectin, collagen, or TGF-β1 signaling proteins. PKR and phosphorylated (p)PKR (thr446) were increased in mdx (p < 0.001) and maintained despite IMX treatment. Similarly, PKR regulators (total PACT, pPACT (ser18), TRBP, and PP1α), and PKR substrates (total eIF2α and peIF2α (ser51)) were also increased with disease (p < 0.001), but unaffected by IMX. Likewise, IMX did not attenuate disease-mediated elevations in inflammatory signaling and ER stress markers. Overall, the dose of IMX was insufficient to attenuate PKR activation and failed to improve muscle function or prevent pathology in dystrophic skeletal muscle.

Open article ↗



2026-09-20 | "Improving the beneficial effects of HDAC8 inhibition by simultaneously activation of SIRT1 in a zebrafish model of Duchenne muscular dystrophy.

Duchenne Muscular Dystrophy (DMD) is a severe genetic disorder characterized by progressive skeletal muscle degeneration, chronic inflammation, fibrosis, and mitochondrial dysfunction. Although gene- and cell-based therapies hold great promise, significant limitations still restrict their broad application, highlighting the need for complementary pharmacological approaches targeting secondary pathological mechanisms. Histone deacetylase (HDAC) inhibitors and Sirtuin 1 (SIRT1) activators represent promising therapeutic strategies, as HDAC8 is involved in cytoskeletal remodeling, whereas SIRT1 mainly regulates mitochondrial metabolism and energy homeostasis. In this study, we investigated the therapeutic efficacy of combining selective HDAC8 inhibition (PCI-34051) with SIRT1 activation (SRT2104) in a zebrafish model of DMD. Combined treatment significantly improved muscle structure and function, reduced inflammatory cell recruitment, and enhanced mitochondrial activity compared with single-drug administration. Importantly, comparable therapeutic efficacy was achieved using reduced doses of both compounds. Proteomic and acetylomic analyses revealed distinct but complementary molecular signatures induced by the two treatments. HDAC8 inhibition predominantly modulated pathways associated with cytoskeletal organization, epigenetic regulation, ribosome biogenesis, and muscle structural remodeling, whereas SIRT1 activation mainly affected mitochondrial function, oxidative metabolism, amino acid catabolism, and cellular bioenergetics. Overall, these findings demonstrate that combined HDAC8 inhibition and SIRT1 activation effectively ameliorate key pathological features of DMD in zebrafish and provide mechanistic insights into the complementary pathways targeted by the two compounds. This work supports the development of combinatorial epigenetic strategies as potential therapeutic approaches for DMD.

Open article ↗



2026-09-19 | β-hydroxy-β-methylbutyrate improves fast-twitch muscle function, histopathology and mitochondrial respiration in the D2.mdx dystrophic mouse.

Duchenne muscular dystrophy (DMD) is a severe inherited muscle disorder caused by mutations that eliminate the protein, dystrophin, resulting in disrupted protein homeostasis, mitochondrial dysfunction, chronic inflammation and progressive muscle degeneration. The leucine metabolite, β-hydroxy-β-methylbutyrate (HMB), has shown therapeutic potential in dystrophic muscle. We previously reported that HMB supplementation improves fast-twitch muscle histopathology and function in juvenile mdx mice during their peak damage phase (3-6 weeks). However, the mdx model exhibits a relatively mild pathology compared to human DMD, limiting clinical relevance. Here, we investigated 8 weeks of HMB supplementation (1 mg g-1 day-1 via drinking water) in the more severe D2.mdx mouse model at 3 and 6 months of age, representing skeletal muscle pathologies consistent with chronic inflammation and advanced muscle fibrosis, respectively. HMB-treated D2.mdx mice had improved grip strength compared to controls, whereas isolated fast-twitch extensor digitorum longus (EDL) muscles displayed increased fibre size, reduced tissue infiltrate and enhanced force production ex vivo. Mechanistically, HMB increased the phospho-to-total ratio of direct downstream mammalian target of rapamycin complex 1 (mTORC1) targets p70S6K1 and 4EBP1, consistent with enhanced anabolic signalling. Mitochondria assessed from treated flexor digitorum brevis muscles exhibited improved respiration and ATP production, with functional improvements aligning with elevated complex II succinate dehydrogenase activity in HMB-treated EDL muscles. By contrast, no significant HMB-induced effects were observed in the slow-twitch soleus muscle. This study is the first to demonstrate that HMB enhances in vivo and ex vivo muscle function, downstream mTORC1 signalling, and mitochondrial performance in the severe D2.mdx model, supporting its potential as a therapeutic strategy for DMD. KEY POINTS: β-Hydroxy-β-methylbutyrate (HMB) supplementation improves skeletal muscle function in the D2.mdx mouse model of Duchenne muscular dystrophy. HMB treatment increased voluntary grip strength and enhanced force production in isolated extensor digitorum longus extensor digitorum longus muscles in 3- and 6-month-old D2.mdx mice. Functional improvements were accompanied by reduced tissue infiltrate, increased mean muscle fibre size, and elevated succinate dehydrogenase activity. Τηεδδ adaptations coincided with increased markers of mammalian target of rapamycin complex 1 signalling, mitochondrial respiration and ATP production, suggesting improved metabolic capacity in dystrophic muscle.

Open article ↗



proteins
2026-08-20 | AAV9-mediated βIII-tubulin Ser172 phospho-mimic expression improves arrhythmic and inflammatory remodeling in dystrophic cardiomyopathy.

Duchenne muscular dystrophy (DMD) cardiomyopathy is characterized by progressive microtubule remodeling, connexin-43 (Cx43) dysregulation, and ventricular arrhythmias. We previously demonstrated phospho-mimic knock-in of βIII-tubulin S172E preserves microtubule organization and attenuates cardiac pathology in mdx mice. However, whether these protective effects can be reproduced using a clinically relevant gene-delivery strategy remains unknown. We generated a cardiomyocyte-specific adeno-associated virus serotype 9 (AAV9) vector expressing phospho-mimic βIII-tubulin (Tubb3-S172E) under the cardiac troponin T promoter and delivered it to 4-5-month-old wild-type and mdx mice. Cardiac Tubb3-S172E expression was confirmed by quantitative qPCR and immunoblotting. In mdx mice, AAV9-mediated Tubb3-S172E expression significantly reduced mononuclear inflammatory infiltration, restored Cx43 localization at intercalated discs, and attenuated isoproterenol-induced arrhythmia susceptibility. In contrast, cardiac fibrosis, Nav1.5 protein expression, and peak sodium current density were not significantly improved. Overexpression of wild-type βIII-tubulin in healthy hearts increased Cx43 lateralization and arrhythmia susceptibility, indicating that βIII-tubulin phosphorylation state rather than protein abundance determines its protective function. Cardiomyocyte-targeted delivery of phospho-mimic βIII-tubulin partially recapitulates the protective effects observed in the genetic S172E knock-in model. These findings identify βIII-tubulin Ser172 phosphorylation as a critical regulator of microtubule-dependent electrical remodeling and support therapeutic modulation of this pathway in Duchenne muscular dystrophy cardiomyopathy. Cardiomyocyte-targeted AAV9 delivery of phospho-mimic âIII-tubulin improves Cx43 organization, inflammatory remodeling, and arrhythmia susceptibility in dystrophic hearts, demonstrating that therapeutic modulation of βIII-tubulin Ser172 phosphorylation partially recapitulates the protective effects observed in the genetic S172E model.The dissociation between improved electrical remodeling and persistent Nav1.5 and fibrotic abnormalities suggests that βIII-tubulin Ser172 phosphorylation selectively regulates specific microtubule-dependent pathological pathways in dystrophic cardiomyopathy.Future studies should define the molecular mechanisms linking βIII-tubulin Ser172 phosphorylation to cardiomyocyte-immune cell communication and determine how this pathway coordinates electrical and inflammatory remodeling in dystrophic hearts.

Open article ↗



2026-08-14 | Lipin1 restores nNOS sarcolemmal localization and improves fatigue resistance in Duchenne muscular dystrophy.

In Duchenne muscular dystrophy (DMD), nNOS is mislocalized from the sarcolemmal membrane and exhibits reduced expression and activity, impairing vasomodulation and contributing to increased muscle fatigue. Identification of upstream regulators that restore nNOS localization and function may provide therapeutic strategies to improve muscle performance in dystrophic muscle. In this study, we investigated the role of lipin1 in regulating nNOS expression, sarcolemmal localization, and NOS activity in skeletal muscle. Lipin1 deficiency significantly reduced nNOS expression and total NOS enzymatic activity, whereas lipin1 overexpression enhanced these parameters. Skeletal muscle-specific lipin1 knockout mice (lipin1Myf5cKO) exhibited increased muscle fatigue, consistent with impaired nNOS-dependent muscle function. In contrast, transgenic lipin1 restoration in dystrophic muscle (mdx:lipin1Tg/0) restored nNOS expression and sarcolemmal localization and improved fatigue resistance. Our findings suggest that lipin1 promotes nNOS sarcolemmal localization, potentially through stabilization of membrane-associated protein complexes, and enhances nNOS expression through a lipin1/DAG/PKD/CREB signaling axis. Collectively, these findings identify lipin1 as an important regulator of nNOS expression and localization in skeletal muscle and support lipin1 restoration as a potential therapeutic strategy for DMD.

Open article ↗



2026-08-10 | Reduced Cx43 S-nitrosylation protects against cardiac stress-induced arrhythmias and myocardial injury in Duchenne Muscular Dystrophy.

In Duchenne muscular dystrophy (DMD), connexin-43 (Cx43) delocalizes from intercalated discs to the lateral membrane of cardiomyocytes, where it forms undocked hemichannels. β-adrenergic stress induces lethal arrhythmias in DMDmdx mice that correlate with increased Cx43 S-nitrosylation and excessive hemichannel opening. Here, we aimed to determine whether S-nitrosylation of Cx43 at cysteine 271 directly contributes to β-adrenergic stress-induced arrhythmias and myocardial injury in DMD. To define the role of Cx43 S-nitrosylation in DMD cardiomyopathy, we generated DMDmdx knock-in mice carrying a cysteine-to-serine substitution at residue 271, a critical S-nitrosylation site involved in NO-dependent Cx43 hemichannel activation (DMDmdx:C271S+/-). Following β-adrenergic stimulation, DMDmdx mice exhibited a higher incidence of arrhythmogenic events and increased triggered activity in isolated cardiomyocytes compared with DMDmdx:C271S+/- mice, which more closely resembled wild-type mice. Optical mapping of isolated hearts showed that DMDmdx mice developed abnormal Ca2+ transients, prolonged action potentials, and episodes of conduction block. These abnormalities were normalized in DMDmdx:C271S+/- mice and attenuated by treatment with the Cx43 hemichannel inhibitor Gap19. Moreover, β-adrenergic stress evoked severe myocardial injury and bradycardia in DMDmdx mice, both of which were significantly attenuated in DMDmdx:C271S+/- mice. Notably, Gap19-treated DMDmdx mice were protected against myocardial injury, further supporting a direct role for Cx43 hemichannels in DMD-associated cardiac damage. These findings reveal, for the first time, a mechanistic link between Cx43 hemichannel activity, arrhythmogenesis, and myocardial injury in DMD. We conclude that S-nitrosylation of Cx43 is a fundamental NO-mediated mechanism driving β-adrenergic stress-induced arrhythmias and myocardial injury in DMDmdx mice through pathological opening of Cx43 hemichannels.

Open article ↗



2026-06-25 | The Multi-System Roles of Dp71 Dystrophin Isoforms in Duchenne Muscular Dystrophy.

The DMD gene is best known for its product dystrophin, a large rod-shaped protein that plays a critical role in muscular membrane strength and integrity. Mutations affecting dystrophin lead to Duchenne muscular dystrophy, a fatal X-linked disease characterized by muscular weakness and breakdown. In addition to the full-length dystrophin product that is most often associated with disease, the DMD gene also encodes multiple shorter isoforms of dystrophin with diverse functions. One isoform in particular, Dp71, has been increasingly found to play a wide variety of roles throughout the body. In this narrative review, we consolidate the numerous studies on Dp71 to provide a comprehensive foundation for future work. We outline and summarize the current state of knowledge on the role of Dp71 in the brain, the retina, and skeletal muscles, identifying current knowns and unknowns in the field. We also explore Dp71-based therapies currently being tested in the pre-clinical landscape and identify potential limitations for clinical translation.

Open article ↗



2026-06-22 | High-throughput discovery of arginine-depleted peptides enables effective antisense delivery for Duchenne muscular dystrophy.

Phosphorodiamidate morpholino oligomers (PMOs) are approved exon-skipping antisense therapeutics for Duchenne muscular dystrophy (DMD), but their clinical utility is limited by poor uptake in muscle tissue, necessitating frequent high-dose administration. Cell-penetrating peptides (CPPs) can enhance intracellular delivery of PMOs, yet conventional arginine-rich CPPs often cause dose-limiting toxicity, including renal damage, which hinders their clinical translation. To address this challenge, we developed a high-throughput, charge-based chromatographic enrichment platform capable of screening over 15,000 synthetic peptides, including sequences with noncanonical (abiotic) amino acids. This approach enabled de novo discovery of arginine-depleted CPPs with improved delivery profiles. Four lead candidates demonstrated efficient nuclear PMO delivery with ~10-fold lower in vitro toxicity compared to standard CPPs such as penetratin. The top-performing peptide, CXP1, showed robust splice-switching activity and favorable tolerability in both cellular and animal models. In dystrophic mdx mice, CXP1-PMO conjugates achieved greater exon skipping compared to PMOs conjugated to R6G at equivalent doses. Tissue levels of CXP1-PMO correlated with exon-skipping efficacy, establishing a clear pharmacokinetic-pharmacodynamic relationship. These findings highlight a mechanistically novel and translationally relevant discovery strategy, demonstrating the potential of high-throughput platforms to generate more effective CPP-based delivery vehicles for antisense therapeutics in DMD and related neuromuscular disorders.

Open article ↗



oligonucleotides
2026-08-21 | Four new mouse models of Duchenne muscular dystrophy with clinically relevant exon deletions in the human DMD gene.

Variant-specific therapeutic approaches, such as exon skipping or gene editing, hold promise for the treatment of Duchenne muscular dystrophy (DMD). Translatability of preclinical studies investigating these approaches could greatly be improved through the use of humanized mouse models, as these allow preclinical testing of human-specific sequences. We developed four novel humanized mouse models of DMD with a deletion of exon 44, 45, 51 or 53 in the human DMD gene, in a mouse dystrophin-negative background (mdx mouse; exon 23 nonsense mutation). Our optimized prescreening pipeline allowed us to do so very efficiently with the CRISPR-Cas9 technology. We confirmed either complete lack of dystrophin or expression of trace levels, which led to development of muscle pathology consisting of muscle fiber degeneration and regeneration, inflammation and fibrosis in young adult mice. Intramuscular treatment with vivo-morpholinos targeting a flanking exon induced exon skipping in the DMD strains, which restored the disrupted open reading frame and, subsequently, dystrophin expression. This validates these models as valuable tools for preclinical studies investigating human sequence-specific therapeutic approaches for DMD.

Open article ↗



2026-07-15 | AI-powered therapeutic aptamer drug discovery: Targeting the CT-domain of CTGF for duchenne muscular dystrophy.

Duchenne muscular dystrophy (DMD), a fatal X-linked disorder, features progressive muscle fibrosis as a key driver of mortality. While CTGF represents a therapeutic target for DMD, its VWC-domain-targeting antibody (FG-3019) failed in clinical trials. Through experimental validation, we identified CT-domain as a superior target domain, as it contributed more fibrosis activity of CTGF than VWC-domain without elevating compensatory TGF-β1 level. Aptamers are synthetic oligonucleotides identified through SELEX, which can specifically bind to flexible protein domains through their unique 3D conformations. Their small molecular size enables effective tissue penetration while maintaining high target specificity, making them ideal CT-domain inhibitors. Nevertheless, conventional SELEX involves time-consuming and inefficient multiple screening rounds. Here, we employed our generative AI model, AptGEN, to rapidly discover a potent CT-domain specific aptamer within 42 days. This chemically modified aptamer (Apc003OA) distributed and remained in muscle tissues for an extended period, whereas FG-3019 could not. Importantly, it demonstrated better fibrosis inhibitory activity in vitro and in mdx mice when compared to FG-3019. Furthermore, Apc003OA demonstrated a favorable safety profile in mdx mice. Within 10 months, we progressed from target domain discovery, aptamer drug discovery, and then obtained both Orphan Drug Designation and Pediatric Rare Disease Designation by US Food and Drug Administration.

Open article ↗



2026-07-13 | CPP2Vec: A representation learning approach for cell-penetrating peptides prediction.

Cell-penetrating peptides (CPPs) facilitate the delivery of a variety of therapeutic molecules across the plasma membrane, from small chemical substances to nucleic acid-based macromolecules, such as antisense oligonucleotides (ASOs). Among neutral ASOs, peptide nucleic acids (PNAs) and phosphorodiamidate morpholino oligomers (PMOs) have been extensively studied as potential medical treatments for Duchenne Muscular Dystrophy (DMD), a severe genetic disease that causes muscle degeneration progressively. Over the last few decades, many in silico methods have emerged to detect novel CPPs, counterbalancing the cost of wet-lab experiments. In this study, we propose CPP2Vec, a Word2Vec-based CPP prediction method, where the Word2Vec technique is used to represent amino acid sequences of peptides. To address the limited sequence diversity, sparse biological grounding, and the still poorly understood mechanisms underlying CPPs uptake, we constructed CPP2Vec-GenSet, a hybrid dataset that integrates computationally generated peptides with experimentally curated CPPs. This combined resource provides a robust training foundation that supports reliable representation learning and enhances cross-task model performance. Using this framework, we developed three task-specific supervised machine learning models for CPP-Classification, Uptake-Efficiency and PMO-Delivery. The first two models were designed to determine if an unseen peptide is a CPP and to predict its uptake efficiency, respectively, while the PMO-Delivery model predicts whether a peptide could enhance the cellular delivery of a PMO-complex compared to its naked version. Furthermore, we explored an alternative approach using pre-trained protein-based Large Language Models (LLMs) - ProtT5, ProtBERT, and ESM-2 - to generate the embeddings, resulting in three task-specific models, namely CPP2LLM. Benchmarking against state-of-the-art CPP prediction tools demonstrates that CPP2Vec achieves robust predictive performance and generalization across tasks, while maintaining exceptional computational efficiency. In this research, we present a Machine Learning (ML)-based tool that introduces the use of the Word2Vec technique in the field of CPPs prediction. Notably, CPP2Vec automatically learns informative peptide representations directly from sequence data, generalizes reliably across multiple tasks, and achieves high predictive performance with minimal computational resources, providing a reproducible and practical in silico tool to support the early-stage identification and prioritization of CPPs with potential therapeutic relevance. CPP2Vec is available for use at: https://github.com/SSvolou/CPP2Vec.

Open article ↗



2026-06-06 | A Real-World Target Trial Emulation of Eteplirsen, Casimersen, and Golodirsen to Evaluate Survival Among Patients with Duchenne Muscular Dystrophy.

Real-world data are needed to understand the treatment effect of eteplirsen, casimersen, and golodirsen (phosphorodiamidate morpholino oligomers [PMOs]) on all-cause mortality in patients with DMD. The study objectives were to describe the unadjusted time to death from treatment start and from birth, assess PMO treatment's impact on survival, and describe the frequency of comorbidities prior to death. Sequential target trial emulation with inverse probability of treatment and censoring weighting were used to compare survival between patients who received glucocorticoids (GCs) and eteplirsen, casimersen, or golodirsen (PMO + GCs) or GCs alone (GCs-only). Inovalon closed claims data (January 2016-September 2024) were tokenized and linked with Datavant mortality data. In the PMO + GCs group, 208/372 (56%) received eteplirsen, 123/372 (33%) casimersen, and 41/372 (11%) golodirsen. Twelve of 372 patients (3%) died after treatment initiation with PMO + GCs versus 114/2656 (4%) for GCs-only without adjustment for confounding or length of follow-up. In the adjusted target trial emulation analysis, 112 patients initiated PMOs and 2916 initiated GCs-only treatment in the first trial; median follow-up time was 4.6 and 4.8 years, respectively. In sequential trials, 260/2916 patients originally in the GCs-only group initiated treatment with PMOs. While the mortality rate in both groups was low, data from 48 sequentially emulated trials estimated PMO + GCs reduced mortality risk versus GCs-only (hazard ratio 0.303; 95% confidence interval 0.119-0.769; P = 0.012). In patients from either group with claims in the 3 months preceding death (n = 84), more than 75% had circulatory/respiratory claims. The relative risk reduction in mortality suggests a promising treatment effect of PMO + GCs versus GCs-only, which should be confirmed in future studies with longer follow-up.

Open article ↗



2026-04-22 | Transforming Duchenne muscular dystrophy therapy: The multifaceted role of extracellular vesicles and exosomes.

Duchenne muscular dystrophy (DMD) remains a devastating X chromosome-linked disorder with restricted curative options. Additionally, the existing treatment approaches, such as growth-modulating agents, anti-inflammatory drugs, antisense oligonucleotides with exon-skipping capabilities, stop codon mutation suppressors, vector-mediated gene therapy, CRISPR/Cas9 gene editing, and exogenous cell transplantation, can delay disease progression but are not curative. Extracellular vesicles (EVs), especially exosomes, nanoscale vesicles involved in intercellular communication, have emerged as promising therapeutic tools for DMD due to their low immunogenicity, ability to deliver therapeutic cargos, and potential to modulate inflammation, oxidative stress, and fibrosis. This review explores the transformative role of EVs (including exosomes) as multifunctional tools in DMD management. Natural EVs, enriched with regenerative microRNAs (miRNAs) and anti-fibrotic proteins, modulate inflammation, oxidative stress, and muscle degeneration. Besides, innovative engineering approaches could improve EVs' cargo loading and targeting, assisting efficient delivery of oligonucleotides and CRISPR/Cas9 editing components. Furthermore, we address the capacity of these vesicles to restore dystrophin expression and attenuate pathogenic mechanisms. Lastly, challenges associated with EV isolation, stability, and scalability are critically evaluated to support the development of an integrated cell and gene therapy framework with significant potential to improve clinical outcomes in DMD patients.

Open article ↗



other
2026-09-25 | Gene-Corrected Human iPSC-Derived Cardiomyocytes and Skeletal Muscles Reveal Partial Dystrophin Dp427 Preservation and Cardiac Dp116 Expression in Duchenne Muscular Dystrophy Patient With a Splice-Site Mutation in Intron 68 (c.9975-1G>T).

Duchenne muscular dystrophy (DMD) is a severe X-linked neuromuscular disease caused by mutations in the DMD gene, leading to the absence or dysfunction of dystrophin. Although cardiac and skeletal muscles are both affected, tissue-specific differences in disease manifestation and dystrophin regulation remain poorly understood. To investigate these differences, we established a human induced pluripotent stem cell model of DMD from peripheral blood mononuclear cells of a patient (DMD patient with a point mutation in intron 68 (c.9975-1G>T) investigated in the study [DMB15]) carrying a splice-site mutation in intron 68 (c.9975-1G>T). An isogenic control line was generated via clustered regularly interspaced short palindromic repeats/clustered regularly interspaced short palindromic repeats-associated protein 9 correction. Both repaired and DMD human induced pluripotent stem cells were differentiated into cardiomyocytes (DMB15-CMs) and skeletal muscle cells (DMB15-derived skeletal muscle cells); the skeletal muscle lineage included a myoblast (DMB15-derived myoblasts) stage. Transcript and protein analyses were performed, along with functional assessments using microelectrode array recordings and calcium handling analysis. Transcript analysis revealed an in-frame deletion of 2 amino acids (Tyr3325 and Arg3326) due to skipping of the first 6 nucleotides of exon 69. Despite this, near full-length Dp427 (full-length dystrophin isoform of 427 kDa) was detected by Western blot, along with expression of Dp116 (dystrophin isoform of 116 kDa) in DMB15-CMs. Dystrophin levels were preserved in DMD DMB15-CMs but markedly reduced in DMB15-derived skeletal muscle cells, suggesting tissue-specific regulation. Analysis of DMB15-derived myoblasts demonstrated possible changes in myogenic program activation, alongside inconsistent expression of utrophin, the dystrophin paralogue. Functional analysis showed altered β-adrenergic responsiveness in DMD DMB15-CMs, with increased beating frequency and accelerated repolarization on isoproterenol stimulation. DMB15-CMs showed largely preserved basal Ca2+ cycling but failed to maintain a normal amplitude response under β-adrenergic stimulation. Our study identifies a splice-site DMD gene mutation that preserves high levels of dystrophin expression in cardiac muscle but reduced in skeletal muscle and reveals Dp116 expression in cardiomyocytes. These findings highlight the importance of tissue context in DMD and demonstrate the power of human induced pluripotent stem cell-based systems for dissecting mutation-specific effects.

Open article ↗



2026-07-30 | Deramiocel heart-derived cellular therapy in advanced Duchenne muscular dystrophy (HOPE-3): a phase 3, randomised, double-blind, placebo-controlled trial.

Duchenne muscular dystrophy (DMD) is an X-linked genetic disease of skeletal and cardiac muscle that leads to loss of ambulation and premature death due to progressive myopathy and cardiomyopathy. Deramiocel, a heart-derived cellular therapy consisting of human allogeneic cardiosphere-derived cells, improved cardiac and skeletal muscle function in phase 1-2 studies of DMD. Our aim was to assess the efficacy and safety of deramiocel in advanced DMD and support the findings of HOPE-2. HOPE-3, a phase 3, multicentre, randomised (1:1), double-blind, placebo-controlled study, included participants aged 10 years or older with DMD. Investigational product was infused intravenously every 3 months in outpatient settings. Skeletal and cardiac function was evaluated at 12 months. The primary endpoint was total Performance of the Upper Limb 2.0 (PUL2.0) percentage change from baseline. The trial is registered with ClinicalTrials.gov (NCT05126758). Between June 22, 2022, and May 28, 2024, 139 participants were screened, of whom 106 were randomly assigned to deramiocel (n=54) or placebo (n=52), and included in the intention-to-treat population. The primary endpoint showed significant improvements in the deramiocel group versus placebo. For total PUL2.0, least-squares mean percentage change at 12 months favoured deramiocel by 4·55% (95% CI 0·47-8·63; p=0·029). The safety profile of deramiocel was similar to that of placebo. Deramiocel safely slows disease progression in advanced DMD, preserving skeletal muscle function. Administered quarterly in a simple outpatient regimen, deramiocel is a promising treatment for DMD, agnostic to the precise underlying genetic lesion. Capricor Therapeutics.

Open article ↗



2026-07-27 | Engineered exosomes improve myocardial cell membrane integrity and heart function in dystrophic cardiomyopathy.

Duchenne muscular dystrophy (DMD)-associated cardiomyopathy is a leading causes of premature death, yet treatment options remain limited. In this study, we developed the easily accessible engineered exosomes for treatment of DMD-associated cardiomyopathy and explored the underlying mechanisms in DmdΔ4 mice, a model harboring hot spot mutation in the dystrophin gene. DmdΔ4 mice and their cardiomyopathy phenotype were confirmed by Sanger sequencing, pathological staining, flow cytometry, immunoblotting, single-cell sequencing and echocardiographic analysis. Engineered exosomes, exosomes- cardiac homing peptide (Exo-CHP), were synthesised and characterised by click chemistry and miRNA sequence, separately. The targeted ability and the therapeutic effects of Exo-CHP were studied in vitro and in vivo. Primary cardiomyocytes were used to study the underlying mechanism of Exo-CHP. DmdΔ4 mice showed an obvious cardiomyopathy-associated phenotype. Exo-CHP can target myocardium and mitigate pathological progression of cardiomyopathy in DmdΔ4 mice. The therapeutic effects of intravenously delivered Exo-CHP significantly reduced myocardial inflammation, fibrosis and improved the mice's cardiac function. The rescue effects were mediated through the regulation of gene expression at the transcriptomic level, prevention of dystrophin protein complex degradation, and inhibition of intracellular calcium influx and calpain protease activity. The miR-21 knockdown Exo-CHP can counteract the protective effects of Exo-CHP on the calcium content and membrane integrity of primary DmdΔ4-derived cardiomyocytes. Our study demonstrated the feasibility, efficacy and the possible mechanism of mesenchymal stromal cell-derived engineered exosomes, positioning them as a potential cell-free intervention for DMD-associated cardiomyopathy.

Open article ↗



2026-06-12 | Skeletal-muscle-targeted non-viral delivery of full-length DMD mRNA for Duchenne muscular dystrophy.

Duchenne muscular dystrophy (DMD) is a severe, progressive muscle-wasting disorder caused by mutations in the DMD gene, which encodes dystrophin. Although gene therapy using viral vectors has shown promise for the treatment of DMD, the clinical application of viral gene therapies is limited by vector toxicity, immunogenicity and the inability to package full-length dystrophin. Recent advances in messenger RNA (mRNA) technology offer a non-integrating, transient approach to restoring protein expression. Here we report the systemic delivery of skeletal-muscle-targeted full-length DMD mRNA in a murine model of DMD using allogenically engineered targeting extracellular vesicles (DMD t-EVs). This approach restores the endogenous translation of wild-type dystrophin and substantially improves muscle function. We further demonstrate the safety and biocompatibility of DMD t-EVs in non-human primates, supporting their translational potential. These findings highlight the promise of mRNA-loaded extracellular vesicles as a therapeutic platform for treating genetic disorders involving large, difficult-to-package genes.

Open article ↗



2026-06-04 | Microbiota dysbiosis influences immune system and muscle pathophysiology of dystrophin deficient mice.

Duchenne muscular dystrophy (DMD) is a progressive, severe muscle-wasting disease caused by mutations in DMD, encoding dystrophin, that leads to loss of muscle function with cardiac/respiratory failure and premature death. Since dystrophic muscles are sensed by infiltrating inflammatory cells, and gut microbial communities can cause immune dysregulation and metabolic syndrome, we sought to investigate whether intestinal bacteria support the muscle immune response in the mdx dystrophic murine model. We highlighted a strong correlation between DMD disease features and the relative abundance of Prevotella. Furthermore, the absence of gut microbes through the generation of mdx germ-free animal model, as well as modulation of the microbial community structure by antibiotic treatment, influenced muscle immunity and fibrosis. Intestinal colonization of mdx mice with eubiotic microbiota was sufficient to reduce inflammation and improve muscle pathology and function. This work identifies a potential role for the gut microbiota in the pathogenesis of DMD.

Open article ↗



Access all drug discovery papers and probability of success in trials forecasts:

Access all drug discovery papers and probability of success in trials forecasts:

Request access

Request access

Drug Discovery Landscape

155 orphan drug designations for Duchenne muscular dystrophy, including 10 approved therapies.

155 orphan drug designations for Duchenne muscular dystrophy, including 10 approved therapies.

Drug

Therapy type

Orphan designation

Clinical trial status

Sponsor

human umbilical cord derived mesenchymal stem cells

cell therapies

FDA
2026-09-22

Phase II
Ongoing

Signature Biologics

tegacorat

small molecules

FDA
2026-06-11

—

GRT Therapeutics, Inc.

4-chloro-N-{4-[(morpholin-4-yl) methyl] phenyl}benzamide phosphoric salt

small molecules

FDA
2026-04-28

—

GEn1E Lifesciences Inc.

Adeno-associated virus serotype SLB101 containing the human microdystrophin gene

gene therapies

EMA
2026-04-20

Phase III
Ongoing

Voisin Consulting Life Sciences

small-molecule histone deacetylase 6 inhibitor

small molecules

FDA
2026-04-17

—

Tenaya Therapeutics, Inc.

human Wharton¿s jelly derived mesenchymal stem cells

cell therapies

FDA
2026-02-05

Phase I/II
Ongoing

ENCell Co., Ltd.

(Z)-endoxifen

small molecules

FDA
2026-01-15

—

Atossa Therapeutics, Inc.

sitagliptin

small molecules

FDA
2026-01-15

—

Revio Therapeutics LLP

inotodiol

other

FDA
2025-09-08

—

AniMusCure Inc.

all-P-ambo- [2',3'-Azanediyl-P,2',3'-trideoxy-P-(dimethylamino)-2',3'-seco](2'-N 5')(TCGGTAAGTTCTGAGATGGCATTTC)

oligonucleotides

FDA
2025-09-05

Phase II
Ongoing

NS Pharma, Inc.

single-stranded, non-replicating, recombinant adeno-associated virus serotype 9 (AAV9) vector containing alpha-myosin-heavy-chain/murine muscle creatine kinase 7 (MHCK7) promoter and micro-dystrophin elements

gene therapies

FDA
2025-08-25

Phase I
Ongoing

Insmed Gene Therapy LLC

modified activin receptor IIA and activin receptor IIB ligand trap

proteins

FDA
2025-08-18

Phase II
Ongoing

Keros Therapeutics, Inc.

Luminol monosodium

small molecules

EMA
2025-07-18

—

MetrioPharm Deutschland GmbH

Palmitoyl-conjugated tricyclo-DNA antisense oligonucleotide 5'-Palm-C6-*GGA GAT GgC AGT TTC-3

oligonucleotides

EMA
2025-07-18

Phase I/II
Ongoing

SQY Therapeutics

adeno-associated virus serotype 9-delivered DMD19-20L.431 and DMD35-36L.457 nucleases

gene editing enzymes

FDA
2025-07-17

Phase I/II
Ongoing

Precision BioSciences, Inc. (PBI)

cytosine base editing drug containing two adeno-associated virus serotype 9 (AAV9) vectors, ss.AAV9.oTAM and ss.AAV9.hE50-sgRNA

gene editing enzymes

FDA
2025-06-06

—

GENASSIST BOSTON LIMITED

Human induced pluripotent stem cell derived cardiac progenitor cells

cell therapies

FDA
2025-05-27

—

IPS Heart

oxiracetam

small molecules

FDA
2025-05-15

—

KSB TUGEN Bio Inc.

Fragment antibody targeting human TfR1 conjugated to phosphorodiamidate morpholino oligomer

antibodies

EMA
2025-04-16

Phase III
Ongoing

Pharma Gateway AB

Allogeneic cardiosphere-derived cells

cell therapies

EMA
2024-12-13

Phase III
Ongoing

ADOH B.V.

Ifetroban

small molecules

FDA
2024-11-04

Phase II
Completed

Cumberland Pharmaceuticals Inc.

dual vector recombinant adeno-associated virus serotype 9 (rAAV9) delivering a clustered regularly interspaced short palindromic repeat (CRISPR) / CRISPR associated protein (Cas) 9 gene editing therapy

gene editing enzymes

FDA
2024-11-04

—

MyoGene Bio

an adeno-associated virus vector expressing codon-optimized fusion of utrophin and dystrophin (iAAV9.6/shCK.mini-UDYS.spolyA)

gene therapies

FDA
2024-10-25

Phase I/II
Ongoing

Belief BioMed Limited

(3-(1-(2',3'-Dimethoxy-[1,1'-biphenyl]-4-yl)-1H-1,2,3-triazol-4-yl) benzoic acid

small molecules

FDA
2024-09-23

—

Chemicare srl

derivative of 4?methoxy?5?phenoxy?2?(piperidine?1?carbonyl)pyridine

small molecules

FDA
2024-09-23

—

Boehringer Ingelheim Pharmaceuticals, Inc.

a reduced biocompatible ceramic biomaterial that can be suspended and injected into myofascial compartments to degrade and release ions over time, promoting growth factor secretion and the formation of a robust vascular network

other

FDA
2024-09-17

—

DystropHix, LLC

phosphoryl guanidine-modified stereopure splicing antisense oligonucleotide against DMD mRNA inducing exon 53 skipping

oligonucleotides

FDA
2024-09-09

Phase II
Ongoing

Wave Life Sciences

human myogenic satellite cells differentiated in vitro from an induced pluripotent stem cell line

cell therapies

FDA
2024-08-29

—

Somite Therapeutics

a palmitoyl-conjugated tc-DNA antisense oligonucleotide

oligonucleotides

FDA
2024-08-29

Phase I/II
Ongoing

SQy Therapeutics

N-163 beta-glucan

small molecules

FDA
2024-08-21

—

GN Corporation Co. Ltd.

octadecanedioic acid derivative-modified inhibitor of connective tissue growth factor (CTGF)

small molecules

FDA
2024-07-23

—

Aptacure Therapeutics Limited

fixed-dosed combination of L-citrulline + allopurinol

small molecules

FDA
2024-04-30

—

Dr. Noah Biotech, Inc.

small molecule inhibitor of a notch associated kinase that enhances satellite cell driven regeneration of muscle

small molecules

FDA
2024-04-23

Phase II
Ongoing

Satellos Bioscience Inc.

Sevasemten

small molecules

EMA
2024-04-16

Phase II
Ongoing

Les Laboratoires Servier

(-)-epi-gallocatechin-3-gallate

small molecules

FDA
2024-03-21

Phase II/III
Terminated

Merdury Biopharmaceutical Corporation

Enhanced delivery peptide-oligonucleotide conjugate for Duchenne Muscular Dystrophy Exon 51

oligonucleotides

FDA
2024-03-07

Phase II
Terminated

PepGen Inc.

DAsn-Ile-Pro-Nva-Leu-Tyr-DSer-Phe-Ala-DSer

proteins

FDA
2024-02-08

—

Allysta Pharmaceuticals, Inc.

Adeno-associated virus serotype SLB101 containing the human microdystrophin gene (h-muD5)

gene therapies

FDA
2024-01-11

Phase III
Ongoing

Solid Biosciences Inc.

A recombinant adeno-associated virus serotype 9 (rAAV9) vector carrying a compact high-fidelity Cas12i (hfCas12Max) and a CRISPR RNA (crRNA) targeting human DMD exon 51 SD site

gene therapies

FDA
2024-01-04

Phase I
Ongoing

Cholgene Therapeutics, Inc.

Brogidirsen

oligonucleotides

EMA
2023-12-13

Phase II
Ongoing

Medpace Finland Oy

Adeno-associated Virus Vector Expressing Human SERCA2a Gene

gene therapies

FDA
2023-12-06

Phase I
Ongoing

Sardocor Corp.

Humanised IgG1 monoclonal antibody against TfR1 conjugated to exon 44 specific phosphorodiamidate morpholino oligonucleotide via a non-cleavable linker

antibodies

EMA
2023-10-13

Phase III
Ongoing

MWB Consulting

delpacibart zotadirsen

combination

FDA
2023-08-10

Phase III
Ongoing

Avidity Biosciences, Inc.

heterocyclic small molecule kinase inhibitor of a Notch associated kinase that enhances satellite cell driven regeneration of muscle

small molecules

FDA
2023-08-01

Phase II
Ongoing

Satellos Bioscience Inc.

Brogidirsen

oligonucleotides

FDA
2023-07-31

Phase II
Ongoing

NS Pharma, Inc.

luminol monosodium

small molecules

FDA
2023-05-01

—

MetrioPharm AG

fully modified 18-mer oligonucleotide with a TEG modification at its 5' end that binds to exon 51 of dystrophin pre-mRNA

oligonucleotides

FDA
2023-03-27

Phase II
Ongoing

BioMarin Pharmaceutical Inc.

zeleciment rostudirsen

oligonucleotides

FDA
2023-03-21

Phase III
Ongoing

Dyne Therapeutics, Inc.

3-(1-(2',3'-dimethoxy-[1,1'-biphenyl]-4-yl)-1H-1,2,3-triazol-4-yl)benzoic acid

small molecules

EMA
2023-01-13

—

ChemIcare S.r.l.

a DMD exon 44 skipping PMO and a proprietary cyclic peptide, EEV, that is designed to enable robust muscle tissue uptake, high cellular internalization and endosomal escape of oligonucleotide therapeutics

oligonucleotides

FDA
2022-12-16

Phase I/II
Ongoing

Entrada Therapeutics, Inc.

Human induced pluripotent stem cell derived myogenic progenitor cells (GIVI-MPC)

cell therapies

FDA
2022-10-03

—

IPS Heart

Prednisone

small molecules

FDA
2022-07-13

Phase III
Terminated

Sarcomed AB

Elamipretide HCl

peptides

FDA
2022-05-10

—

Stealth Biotherapeutics Inc.

testosterone

small molecules

FDA
2022-01-12

Phase III
Terminated

Sarcomed AB

insulin-like growth factor-1

proteins

FDA
2022-01-10

Phase I/II
Terminated

Sarcomed AB

recombinant AAV8 that contains a vector genome encoding a miniaturized dystrophin protein (microdystrophin)

gene therapies

FDA
2021-11-08

Phase II/III
Ongoing

REGENXBIO Inc.

Pre-Morula Stem Cells

cell therapies

FDA
2021-05-10

—

ReoStem L.L.C.

Glucagon like peptide-1 Elastin like peptide-120 fusion protein

proteins

FDA
2020-12-30

—

ImmunoForge Co., Ltd.

2'-O-(2-methoxyethyl) phosphorothioate antisense oligonucleotide targeting CD49d RNA

oligonucleotides

EMA
2020-12-09

Phase II
Terminated

CATS Consultants GmbH

peptide conjugated phosphorodiamidate morpholino oligomer (PPMO)

oligonucleotides

FDA
2020-11-12

Phase II
Terminated

Sarepta Therapeutics, Inc.

2'-O-(2-methoxyethyl) phosphorothioate antisense oligonucleotide targeting CD49d RNA

oligonucleotides

FDA
2020-10-21

Phase II
Terminated

Percheron Therapeutics Limited

N-Acetylglucosamine

small molecules

FDA
2020-09-23

—

Wellesley Therapeutics, Inc.

Dystrophin Expressing Chimeric Cells derived from allogenic normal human myoblast and autologous DMD myoblast from Duchenne muscular dystrophy affected donor

cell therapies

FDA
2020-08-05

Phase I/II
Ongoing

Dystrogen Therapeutics Corporation

Pax7+ Satellite Stem Cell Therapy

cell therapies

FDA
2020-07-21

—

Vita Therapeutics

Viltolarsen

oligonucleotides

EMA
2020-06-04

Phase III
Ongoing

Medpace Finland Oy

Adeno-associated virus serotype rh74 containing the human micro-dystrophin gene

gene therapies

EMA
2020-02-28

Phase III
Ongoing

Roche Registration GmbH

Pamrevlumab

antibodies

EMA
2019-12-16

Phase III
Terminated

Voisin Consulting Life Sciences

Rasagiline

small molecules

EMA
2019-06-28

—

[INACTIVE] TMC Pharma (EU) Limited

casimersen [Amondys 45]

oligonucleotides

FDA
2019-06-04

Approved
2021-02-25

Sarepta Therapeutics, Inc.

pamrevlumab

antibodies

FDA
2019-04-11

Phase III
Terminated

FibroGen, Inc.

recombinant Mitsugumin 53

proteins

FDA
2019-01-17

—

Axolo Pharma, Inc.

Ex vivo fused normal allogeneic human myoblast with autologous human myoblast derived from Duchenne muscular dystrophy affected donor

cell therapies

EMA
2018-11-19

Phase I/II
Ongoing

Dystrogen Therapeutics Technology Polska Sp. z o.o.

Ex vivo fused normal allogeneic human myoblast with another normal allogeneic human myoblast

cell therapies

EMA
2018-11-19

Phase I/II
Ongoing

Dystrogen Therapeutics Technology Polska Sp. z o.o.

Synthetic stereopure antisense oligonucleotide specific for human dystrophin pre-messenger ribonucleic acid (mRNA)

oligonucleotides

FDA
2018-08-07

Phase II/III
Terminated

Wave Life Sciences Ltd.

Tetracosactide

small molecules

EMA
2018-07-31

Phase II
Terminated

Mallinckrodt Specialty Pharmaceuticals Ireland Limited

Synthetic antisense oligonucleotide directed against human dystrophin pre-mRNA

oligonucleotides

EMA
2018-07-31

Phase II/III
Terminated

Wave life Sciences Ireland Limited

Ex-vivo fused autologous human bone marrow-derived mesenchymal stem cell with allogenic human myoblast

cell therapies

EMA
2018-07-31

Phase I/II
Ongoing

Dystrogen Therapeutics Technology Polska Sp. z o.o.

20-hydroxyecdysone

small molecules

EMA
2018-06-27

Phase I
Terminated

Biophytis

delandistrogene moxeparvovec-rokl [Elevidys]

gene therapies

FDA
2018-06-21

Approved
2023-06-22

Sarepta Therapeutics, Inc.

golodirsen [VYONDYS 53]

oligonucleotides

FDA
2018-05-22

Approved
2019-12-12

Sarepta Therapeutics, Inc.

20-hydroxyecdysone

small molecules

FDA
2018-05-10

—

Biophytis SA

(3R)-3-Methyl-6-[2-({5-methyl-2-[4-(trifluoromethyl)phenyl]-1H-imidazol-1-yl}methyl)phenoxy]hexanoic acid hemisulfate

small molecules

FDA
2018-03-28

Phase I
Terminated

Astellas Pharma Global Development, Inc.

Metformin and L-citrulline

small molecules

EMA
2018-01-17

Phase III
Terminated

Quality Regulatory Clinical Ireland Limited

partial myostatin antigen displayed on the surface of Lactobacillus casei

vaccines

FDA
2017-12-28

Phase I
Terminated

MOA Life Plus. Co. Ltd.

Tamoxifen citrate

small molecules

EMA
2017-11-08

Phase III
Completed

Quality Regulatory Clinical Ireland Limited

rimeporide

small molecules

FDA
2017-09-19

Phase I
Terminated

EspeRare Foundation

non-replicating recombinant adeno-associated virus vector containing 4 antisense sequences designed to target exon 2 in the human DMD gene under the control of U7 small nuclear non-coding RNA

gene therapies

FDA
2017-09-19

Phase I/II
Completed

Nationwide Children's Hospital

cosyntropin

gene therapies

FDA
2017-07-06

Phase II
Terminated

Mallinckrodt ARD Inc.

Recombinant adeno-associated virus serotype 9 vector expressing codon-optimized miniaturized version of DMD gene

gene therapies

FDA
2017-05-22

Phase III
Ongoing

Bamboo Therapeutics, w wholly owned subsidiary of Pfizer

small molecule Mas receptor agonist

small molecules

FDA
2017-04-25

—

Capacity Bio, Inc.

viltolarsen [VILTEPSO]

oligonucleotides

FDA
2017-01-12

Approved
2020-08-12

NS Pharma, Inc.

Recombinant adeno-associated viral vector encoding a human micro-dystrophin gene under the control of a muscle specific promoter

gene therapies

EMA
2016-10-14

Phase I/II
Ongoing

Voisin Consulting Life Sciences

zildistrogene varoparvovec

gene therapies

FDA
2016-08-31

Phase III
Ongoing

Solid Biosciences, Inc.

Fordadistrogene movaparvovec

gene therapies

EMA
2016-08-29

Phase III
Terminated

Pfizer Europe MA EEIG

recombinant human biglycan

proteins

FDA
2016-07-13

—

Tivorsan Pharmaceuticals, Inc.

Vasomera

proteins

FDA
2015-11-19

—

ImmunoForge Co. Ltd.

4-[(7-Methoxy-2,3-dihydro-1,4-benzothiazepin-4(5H)-yl)methyl]benzoic acid, hemifumarate

small molecules

FDA
2015-11-18

—

RyCarma Therapeutics, Inc.

Edasalonexent

small molecules

EMA
2015-10-09

Phase III
Terminated

FGK Representative Service GmbH

Allogeneic human adult stem cells, isolated from skeletal muscle and expanded ex vivo

cell therapies

EMA
2015-07-28

—

Karl Rouger

recombinant adeno-associated virus serotype rhesus 74 (rh74) expressing the human CT GalNac transferase (GALGT2) gene, also called the Sda or Cad GAlNac transferase or b4Galnt2, under control of the muscle creatine kinase (MCK) promoter

gene therapies

FDA
2015-06-16

—

Nationwide Children's Hospital

tadalafil

small molecules

FDA
2015-05-04

Phase III
Terminated

Eli Lilly and Company

Rimeporide

small molecules

EMA
2015-04-24

Phase I
Terminated

Isabelle Aelbrecht

allogeneic cardiosphere-derived cells

cell therapies

FDA
2015-04-21

Phase III
Ongoing

Capricor, Inc.

naproxcinod

small molecules

FDA
2015-03-16

—

Nicox SA

bivalent anti-human myostatin adnectin-IgG1

proteins

FDA
2015-02-10

Phase II/III
Terminated

Genentech, Inc.

Adeno-associated viral vector serotype 8 containing the human MD1 gene

gene therapies

EMA
2014-11-19

Phase II/III
Ongoing

Généthon

Edasalonexent

small molecules

FDA
2014-11-17

Phase III
Terminated

Catabasis Pharmaceuticals, Inc.

17α,21-dihydroxy-16α-methyl-pregna-1,4,9(11)-triene-3,20-dione [AGAMREE]

small molecules

EMA
2014-08-22

Approved
2023-12-15

Santhera Pharmaceuticals (Deutschland) GmbH

Asp-Arg-Val-Tyr-Ile-His-Pro

peptides

EMA
2014-02-19

Phase II
Terminated

Eliquent Life Sciences Limited

Naproxcinod

small molecules

EMA
2013-10-07

—

Nicox S.A.

deflazacort [Emflaza]

small molecules

FDA
2013-08-16

Approved
2017-02-09

PTC Therapeutics, Inc.

angiotensin (1-7)[A(1-7)]

peptides

FDA
2013-07-25

Phase II
Terminated

Constant Therapeutics LLC

R,S-O-(3-piperidino-2-hydroxy-1-propyl)-nicotinic acid amidoxime dihydrochloride

small molecules

EMA
2013-04-26

—

Vudbenk Life Science Kft.

Domagrozumab [RK-35]

antibodies

EMA
2013-02-08

Phase II
Terminated

Pfizer Europe MA EEIG

Exon 52 specific phosphorothiate oligonucleotide

oligonucleotides

FDA
2013-01-23

Phase I/II
Ongoing

BioMarin Pharmaceutical, Inc.

Exon 55 specific phosphorothioate oligonucleotide

oligonucleotides

FDA
2013-01-23

—

BioMarin Pharmaceutical, Inc.

exon 53 specific phosphorothioate oligonucleotide

oligonucleotides

FDA
2013-01-23

—

BioMarin Pharmaceutical, Inc.

Exon 45 specific phosphorothioate oligonucleotide

oligonucleotides

FDA
2013-01-23

—

BioMarin Pharmaceutical, Inc.

O-(3-piperidino-2-hydroxyl-1-propyl)-nicotinic acid amidoxime hydrochloride

small molecules

FDA
2013-01-15

—

Vudbenk Life Science Kft.

Exon 55 specific phosphorothioate oligonucleotide

oligonucleotides

EMA
2012-12-06

—

BioMarin International Limited

Exon 52 specific phosphorothioate oligonucleotide

oligonucleotides

EMA
2012-12-06

—

BioMarin International Limited

recombinant human anti-GDF-8 monoclonal antibody

antibodies

FDA
2012-07-24

Phase II
Terminated

Pfizer, Inc.

Givinostat [DUVYZAT]

small molecules

EMA
2012-07-04

Approved
2025-06-06

Italfarmaco S.p.A.

Halofuginone hydrobromide

small molecules

EMA
2012-04-26

Phase II
Terminated

Biological Consulting Europe Limited

Exon 45 specific phosphorothioate oligonucleotide

oligonucleotides

EMA
2012-04-26

Phase III
Terminated

BioMarin International Limited

Exon 53 specific phosphorothioate oligonucleotide

oligonucleotides

EMA
2012-04-26

Phase I/II
Terminated

BioMarin International Limited

vamorolone [Agamree]

small molecules

FDA
2011-12-02

Approved
2023-10-26

Catalyst Pharmaceuticals, Inc.

5-(ethylsulfonyl)-2-(naphthalen-2-yl)benzp[d]oxazole

small molecules

FDA
2011-11-22

Phase II
Terminated

Summit (Oxford) Limited

halofuginone hydrobromide

small molecules

FDA
2011-10-13

Phase II
Terminated

Akashi Therapeutics, Inc.

laminin-111 (human)

proteins

FDA
2011-07-21

—

Prothelia, Inc.

Ramatercept

proteins

EMA
2010-11-26

Phase II
Terminated

Shire Pharmaceuticals Ireland Limited

deflazacort

small molecules

FDA
2010-09-16

Phase III
Terminated

University of Rochester Medical Center

Peptide that inhibits mechanosensitive ion channel (MSC) activity

peptides

FDA
2010-09-15

—

Rose Pharmaceuticals

adeno-associated viral vector containing modified U11 snRNA

gene therapies

FDA
2010-09-15

—

uniQure Inc.

ActRIIB-IgG1)

proteins

FDA
2010-08-16

Phase II
Terminated

Acceleron Pharma, Inc.

RNA, [P-deoxy-P-(dimethylamino)] (2',3'-dideoxy-2',3'-imino-2',3'-seco) (2'a->5') (C-m5U-m5U-A-C-A-G-G-C-m5U-C-C-A-A-m5U-A-G-m5U-G-G-m5U-C-A-G-m5U), 5' [P-[4-[[2-[2-(2-hydroxyethoxy)ethoxy]ethoxy]carbonyl]-1-piperazinyl]-N,N-dimethylaminophosphonamidate], 3' [2'a-[N2-acetyl-L-arginyl-6-aminohexanoyl-L-arginyl-L-arginyl-beta-alanyl-L-arginyl-L-arginyl-6-aminohexanoyl-L-arginyl-L-arginyl-beta-alanyl-L-arginyl-6-aminohexanoyl-beta-alanyl], octahydrochloride [AVI-5038]

oligonucleotides

EMA
2010-02-02

—

AVI BioPharma International Limited

poloxamer-188 NF

small molecules

FDA
2010-01-19

Phase II
Terminated

Phrixus Pharmaceuticals, Inc.

Exon 44 specific phosphorothioate oligonucleotide

oligonucleotides

FDA
2009-11-05

Phase II
Terminated

BioMarin Pharmaceutical, Inc.

Adeno-associated viral vector serotype 6 containing modified U1 snRNA

gene therapies

EMA
2009-10-08

—

uniQure Biopharma B.V

peptide-conjugated phosporodiamidate morpholino oligomer (PPMO)

oligonucleotides

FDA
2009-09-03

—

Sarepta Therapeutics, Inc.

Exon 51 specific phosphorothioate oligonucleotide

oligonucleotides

FDA
2009-08-25

Phase III
Terminated

BioMarin Pharmaceutical, Inc.

Exon 51 specific phosphorothioate oligonucleotide

oligonucleotides

EMA
2009-02-27

Phase III
Terminated

BioMarin International Limited

Exon 44 specific phosphorothioate oligonucleotide

oligonucleotides

EMA
2009-02-27

Phase II
Terminated

BioMarin International Limited

Ezutromid

small molecules

EMA
2008-12-04

Phase II
Terminated

Summit (Oxford) Limited

RNA, [P-deoxy-P-(dimethylamino)] (2',3'-dideoxy-2',3'-imino-2',3'-seco) (2'a→5')(C-m5U-C-C-A-A-C-A-m5U-C-A-A-G-G-A-A-G-A-m5U-G-G-C-A-m5U-m5U-m5U-C-m5U-A-G), P-[4-[[2-[2-(2-hydroxyethoxy)ethoxy] ethoxy]carbonyl]-1-piperazinyl]-N,N‑dimethylaminophosphonamidate

RNAs

EMA
2008-12-03

Phase III
Ongoing

Sarepta Therapeutics Ireland Limited

eteplirsen [Exondys 51]

oligonucleotides

FDA
2007-10-23

Approved
2016-09-19

Sarepta Therapeutics, Inc.

Idebenone

small molecules

EMA
2007-03-20

Phase III
Terminated

Chiesi Farmaceutici S.p.A.

idebenone

small molecules

FDA
2007-02-16

Phase III
Terminated

Chiesi Farmaceutici S.p.A.

Ezutromid

small molecules

EMA
2006-07-25

Phase II
Terminated

Summit Therapeutics Plc

Drisapersen [PRO046]

oligonucleotides

EMA
2006-02-16

Phase III
Terminated

[INACTIVE] Prosensa B.V.

Exon 46 specific phosphorothioate oligonucleotide

oligonucleotides

FDA
2005-11-18

—

Prosensa Therapuetics BV

Adeno-associated viral vector serotype 2/8 containing modified U7-snRNA gene

gene therapies

EMA
2005-07-27

—

Genethon

Ataluren [Translarna]

small molecules

EMA
2005-05-27

Approved
2014-08-05

PTC Therapeutics International Limited

ataluren

small molecules

FDA
2005-01-10

Phase III
Completed

PTC Therapeutics, Inc.

Mazindol

small molecules

FDA
1986-12-08

—

Collipp, Platon J. M.D.

“Terminated” – programs with discontinued clinical trials, or with no updates reported for 5 years after completion or 12 years after the last trial started.

Explority AI logo

228 Park Ave S,
New York, USA.

At Explority, we build first-of-its-kind AI to bring clarity to the earliest and riskiest stages of pharmaceutical research by forecasting which therapies are most likely to succeed. Explority AI web and mobile applications are properties of the Explority AI Inc., a company registered in the United States (File No. 10320493).
For all questions: support@explority.ai

About

Home

Team

Contact

Our AI

Solutions

How it works

Diseases

More

Blog

Terms of Use

Privacy Policy

Copyright © 2026 Explority AI Inc.

Explority AI logo

228 Park Ave S,
New York, USA.

At Explority, we build first-of-its-kind AI to bring clarity to the earliest and riskiest stages of pharmaceutical research by forecasting which therapies are most likely to succeed. Explority AI web and mobile applications are properties of the Explority AI Inc., a company registered in the United States (File No. 10320493).
For all questions: support@explority.ai

About

Home

Team

Contact

Our AI

Solutions

How it works

Diseases

More

Blog

Terms of Use

Privacy Policy

Copyright © 2026 Explority AI Inc.

Explority AI logo

228 Park Ave S,
New York, USA.

At Explority, we build first-of-its-kind AI to bring clarity to the earliest and riskiest stages of pharmaceutical research by forecasting which therapies are most likely to succeed. Explority AI web and mobile applications are properties of the Explority AI Inc., a company registered in the United States (File No. 10320493).
For all questions: support@explority.ai

About

Home

Team

Contact

Our AI

Solutions

How it works

Diseases

More

Blog

Terms of Use

Privacy Policy

Copyright © 2026 Explority AI Inc.